ID: 1091147057

View in Genome Browser
Species Human (GRCh38)
Location 11:133289253-133289275
Sequence CAAAACATGAAGGAGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 323}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091147057_1091147063 30 Left 1091147057 11:133289253-133289275 CCTGACTTCTCCTTCATGTTTTG 0: 1
1: 0
2: 1
3: 31
4: 323
Right 1091147063 11:133289306-133289328 ATATTAGTGGCCGGGCGCGGTGG 0: 1
1: 17
2: 354
3: 2405
4: 11023
1091147057_1091147060 21 Left 1091147057 11:133289253-133289275 CCTGACTTCTCCTTCATGTTTTG 0: 1
1: 0
2: 1
3: 31
4: 323
Right 1091147060 11:133289297-133289319 AAAATTGACATATTAGTGGCCGG 0: 1
1: 0
2: 0
3: 14
4: 279
1091147057_1091147061 22 Left 1091147057 11:133289253-133289275 CCTGACTTCTCCTTCATGTTTTG 0: 1
1: 0
2: 1
3: 31
4: 323
Right 1091147061 11:133289298-133289320 AAATTGACATATTAGTGGCCGGG 0: 1
1: 0
2: 3
3: 17
4: 249
1091147057_1091147062 27 Left 1091147057 11:133289253-133289275 CCTGACTTCTCCTTCATGTTTTG 0: 1
1: 0
2: 1
3: 31
4: 323
Right 1091147062 11:133289303-133289325 GACATATTAGTGGCCGGGCGCGG 0: 1
1: 0
2: 13
3: 116
4: 918
1091147057_1091147059 17 Left 1091147057 11:133289253-133289275 CCTGACTTCTCCTTCATGTTTTG 0: 1
1: 0
2: 1
3: 31
4: 323
Right 1091147059 11:133289293-133289315 TTTTAAAATTGACATATTAGTGG 0: 1
1: 0
2: 6
3: 66
4: 821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091147057 Original CRISPR CAAAACATGAAGGAGAAGTC AGG (reversed) Intronic
900775722 1:4583933-4583955 CAAAATCTGATGGAGGAGTCTGG + Intergenic
904326767 1:29731590-29731612 GAACACATGAAGGAGGAGTTGGG - Intergenic
904376505 1:30085510-30085532 TGAGACCTGAAGGAGAAGTCGGG + Intergenic
904930820 1:34086273-34086295 CAAAATCTGATGGAGAAGACTGG + Intronic
906225719 1:44119558-44119580 CGTTACATGAAGAAGAAGTCAGG + Intronic
906349555 1:45046264-45046286 CAGAAGAAGAGGGAGAAGTCAGG + Intronic
906420817 1:45665278-45665300 CAAAACATGAAAGACTAGACTGG + Intronic
906557084 1:46722374-46722396 AACAACATGAAGCAGAAGACTGG - Intergenic
907717856 1:56944296-56944318 CCAAAAATGAAGAAGAAATCAGG - Intronic
908861035 1:68490103-68490125 AAAAAATTAAAGGAGAAGTCTGG - Intronic
909575716 1:77173838-77173860 CAAAACAAGATGGAGACCTCAGG - Intronic
909935953 1:81550908-81550930 CAAAACAGGAAGAACAAGTTTGG + Intronic
910407332 1:86903099-86903121 GCAAATATGAAGGAGAAGTATGG - Intronic
910451725 1:87353682-87353704 TAACACATGAAGGAGATGCCTGG - Intergenic
911363059 1:96903226-96903248 AAAAACATAAAAGAGAAGGCAGG - Intergenic
912200023 1:107446339-107446361 CAACTAATGAAAGAGAAGTCAGG + Intronic
913669580 1:121083526-121083548 CAACACAAGAAGGTGAAGTCGGG + Intergenic
914021338 1:143870925-143870947 CAACACAAGAAGGTGAAGTCGGG + Intergenic
914659828 1:149778843-149778865 CAACACAAGAAGGTGAAGTCGGG + Intergenic
915626554 1:157117609-157117631 CAAAACAGGAAGTGAAAGTCTGG - Intergenic
916302639 1:163293334-163293356 CAGAAGATGAAGGAGAAGCAAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918190855 1:182173098-182173120 CTGAACTTGAAGGAGAAGTTAGG - Intergenic
918241339 1:182623130-182623152 CTATACAGGAAGGAGAAGTGGGG - Intergenic
918410490 1:184253582-184253604 GAAAACCTGAAGGAAAAGTGTGG - Intergenic
919646859 1:200103897-200103919 CAGAACAAGAGGGAGAAGTATGG + Intronic
920055051 1:203185380-203185402 CAGAGCCTGAAGGAGAAGTCTGG + Exonic
921029498 1:211325332-211325354 CAGAACAGGAAGGAGAACTTGGG + Intergenic
922071867 1:222202995-222203017 CATAACAGGAAGGACAAGTGTGG - Intergenic
922205683 1:223444001-223444023 GTAAACATGAAGGATAACTCAGG - Intergenic
922360596 1:224818175-224818197 CAAAATCTGATGGAGGAGTCTGG - Intergenic
922371161 1:224911552-224911574 CAGAAGGTGAAGGGGAAGTCAGG + Intronic
922387214 1:225098977-225098999 GAAAGCATGAAGGAGAAGAATGG + Intronic
923506025 1:234607797-234607819 CAGAACCAGAAGGTGAAGTCGGG - Exonic
923766747 1:236899239-236899261 CTAAATATGAAGGAGAGGTTGGG + Exonic
923771297 1:236939980-236940002 CAAAACAAGAAGGAGAACTTAGG + Intergenic
924546005 1:245028662-245028684 CAGAATATGAAGGAGCAATCAGG + Intronic
1062779666 10:190482-190504 CAACACCTGAAGGAGGAGTCTGG - Intronic
1063885246 10:10570755-10570777 AAAAGCATGAATGAGAAGTTAGG + Intergenic
1064225497 10:13480367-13480389 CAAAACAAGAGGGAGAAGAGCGG + Intronic
1064806117 10:19135447-19135469 CAAAACATGAGGGATAGGTCAGG - Intronic
1066099295 10:32103489-32103511 TAAAACATGATGGAGAGGCCGGG + Intergenic
1068178466 10:53492494-53492516 TGATACATGTAGGAGAAGTCAGG + Intergenic
1070542368 10:77425418-77425440 ACAAACATGAAGGAGAAGGCAGG - Intronic
1071174066 10:82902961-82902983 CAAAAAATTAAGGAAAAGTTAGG + Intronic
1071176413 10:82931553-82931575 GAAAACTAGAAGGAGAAGTGAGG - Intronic
1071687448 10:87774967-87774989 CAAAACATGAAATAGAAATAAGG + Intronic
1071947778 10:90666960-90666982 AACAACAGGAAGGAGAAGCCAGG + Intergenic
1071986096 10:91052050-91052072 AAAAACATGAAAGTGAGGTCAGG - Intergenic
1072115306 10:92365012-92365034 TCAAACATGAAGGAGAAATATGG - Intergenic
1073550047 10:104391057-104391079 AAATACATAAATGAGAAGTCTGG - Intronic
1073687074 10:105766425-105766447 CACAACATAAATGAGAAGTTTGG + Intergenic
1074276999 10:112012714-112012736 CAAAGCAGGAAGGAAGAGTCAGG + Intergenic
1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG + Exonic
1077633394 11:3825948-3825970 CAAATCAAAAAGGTGAAGTCAGG - Exonic
1077953128 11:6983827-6983849 CAAAGCATCAAGTAGAAATCTGG + Intronic
1078921465 11:15834917-15834939 AAGAAGAAGAAGGAGAAGTCTGG - Intergenic
1078963837 11:16313430-16313452 CAAACCATGAAGTAGATGTGAGG + Intronic
1079406078 11:20147161-20147183 CAATACATGGATGACAAGTCTGG + Intergenic
1079786059 11:24674314-24674336 CAAAGGATGAAAGAGATGTCGGG - Intronic
1080029078 11:27642047-27642069 CAAAACATGAAGGAGAAATTGGG - Intergenic
1081413632 11:42788046-42788068 CAAAACAACAAGGAGAAATATGG - Intergenic
1082647281 11:55743282-55743304 TAAAACATGAAGGAGAAAGGTGG + Intergenic
1083526800 11:63374740-63374762 AAATACATGATGGAGAAGTTTGG + Intronic
1085079541 11:73622776-73622798 AAAAAAAAGAAGGAGAAGTTTGG + Intergenic
1085543379 11:77294135-77294157 CAAAACATGAATGGGAAAACTGG + Intronic
1086232763 11:84590439-84590461 CAAAGCATGAAGGCGCTGTCAGG - Intronic
1088348660 11:108860018-108860040 CAAAACAAGAAGAAGAAGAAAGG - Intronic
1088639544 11:111858228-111858250 AAAAACAGGAAGGAGAGGCCAGG - Intronic
1088946298 11:114516831-114516853 CAAAACTAGAAGAAGAAGTAGGG - Intergenic
1089015350 11:115160922-115160944 TAAAAAGGGAAGGAGAAGTCAGG - Intergenic
1091016663 11:132057632-132057654 GAGACCATGAAGGAGAAGACAGG - Intronic
1091147057 11:133289253-133289275 CAAAACATGAAGGAGAAGTCAGG - Intronic
1091198639 11:133753317-133753339 CACAGCATGAGGGAGAAGCCTGG + Intergenic
1091802251 12:3331599-3331621 CAAAACACGAAGCAGGATTCAGG - Intergenic
1094539352 12:31350295-31350317 CTATAAATGAAGGAGAAGTGTGG - Intergenic
1095820145 12:46469437-46469459 AAAAACAAGTAGGAGAATTCAGG + Intergenic
1096266829 12:50130155-50130177 GCAAAAAAGAAGGAGAAGTCTGG + Exonic
1096847450 12:54415536-54415558 CAGAATATGAAGCAGAAATCAGG + Intronic
1097092317 12:56516585-56516607 CAAAAGAAGAAGAAGAAATCTGG + Intergenic
1098465030 12:70776788-70776810 CAAAAGAAGGGGGAGAAGTCAGG - Intronic
1098648522 12:72936865-72936887 CATATCATGTAGGAAAAGTCTGG + Intergenic
1098856299 12:75656622-75656644 CAAAACATGCTGGAGAAACCAGG + Intergenic
1099297882 12:80852938-80852960 CAAGACAAGAAGTAGAAGACAGG - Intronic
1099343496 12:81468937-81468959 CAAACCATGAGAGAGAAATCTGG + Intronic
1099620796 12:85000717-85000739 AAAAACATGAAAGAGAAGACAGG - Intergenic
1100115959 12:91304584-91304606 CATAACTTGAGGGGGAAGTCAGG - Intergenic
1100538031 12:95529714-95529736 CAAAAGATGAAGGAGAGGCCGGG - Intronic
1101931255 12:109015974-109015996 CAAAACACTAAGAAGATGTCTGG - Intronic
1101958567 12:109231282-109231304 GAAAAAATCATGGAGAAGTCTGG - Intronic
1102151478 12:110691397-110691419 TAATACATGACTGAGAAGTCAGG - Intronic
1102151631 12:110692421-110692443 CAATACTTAAAGGAGAAGGCCGG + Intronic
1103801335 12:123539616-123539638 GAAAACAGGCAGGAGAAGTCTGG - Intergenic
1103985631 12:124765608-124765630 CAAAACAGGAAAGAGAGGGCAGG - Intergenic
1105303337 13:19153651-19153673 CACAACAGGAAGGAGCAGCCAGG + Intergenic
1105839137 13:24238450-24238472 TAAAACATCAAGGAGAGGCCGGG - Intronic
1106230768 13:27819653-27819675 CAAAGCATGAGTGGGAAGTCAGG + Intergenic
1107524756 13:41219542-41219564 TAAAAAATGAAGGAGAAGAAAGG + Intronic
1109041214 13:57339616-57339638 TAAAATCTGAAAGAGAAGTCTGG + Intergenic
1109374338 13:61470159-61470181 CAAGAGATGAAGGAGAATTGGGG - Intergenic
1110119181 13:71862502-71862524 CAAAACATGAAAGAAATGTAAGG - Intronic
1110372544 13:74756177-74756199 AAAAGCATGAAGGAGAAGCATGG + Intergenic
1112152739 13:96781904-96781926 CAAACCTTGAAGGAAAAATCAGG + Intronic
1112273228 13:97989931-97989953 GAAAACATACTGGAGAAGTCTGG - Intronic
1113111053 13:106823963-106823985 TAAAACATGAAGAAGAGGCCGGG - Intergenic
1114506112 14:23215221-23215243 CAAAAAATGAAGGAGAAGCAAGG - Intronic
1114924532 14:27378255-27378277 CTAAAAATGAAGGAGAAATTGGG + Intergenic
1115989577 14:39138586-39138608 CAAATGATGAAAGAGAAATCTGG - Intergenic
1116466107 14:45234612-45234634 CAAAATATGAAGGAGTCATCAGG + Intronic
1116916862 14:50533038-50533060 CAAAACAGGAAGGTGCAGTAGGG - Intronic
1117632377 14:57707474-57707496 CAGAACGTGAAGGGGAAGTAAGG - Intronic
1117770104 14:59125516-59125538 AACAAGCTGAAGGAGAAGTCTGG - Intergenic
1118075698 14:62296158-62296180 CCTCACATGAAGGAGAAGTTTGG + Intergenic
1121388111 14:93548662-93548684 CAAAACCTGAAAGGGAAGTATGG - Intronic
1124697341 15:31875523-31875545 TAAAAAATGAAGGAGAGGCCGGG - Intergenic
1124763171 15:32464973-32464995 CAAAACTTGAAGGTCAAGTGTGG - Intergenic
1125975375 15:43946574-43946596 GAAAACATGAAGGATATGTCTGG + Intronic
1126070422 15:44861029-44861051 CAAAACAGGAAGCAAAAGGCAGG + Intergenic
1126709239 15:51439360-51439382 CCAAACAAGAAGGAGAAATAAGG - Intergenic
1126811170 15:52406046-52406068 CAGAACTTGAAGGATAAGGCAGG + Intronic
1127102511 15:55581909-55581931 CAAAACATTAAGGAGAGGCCGGG + Intronic
1128998757 15:72316275-72316297 CCAAAAAGGAAGGGGAAGTCTGG - Intronic
1130419408 15:83728980-83729002 TTAAACATGAAGGAGAAATAAGG - Intronic
1131412771 15:92224487-92224509 CAAAAGATGAAGGGGAAGCAAGG + Intergenic
1131908644 15:97171878-97171900 CAAATCTTGAGGGTGAAGTCAGG - Intergenic
1132063735 15:98713531-98713553 CCAAAGATGATGGAGAAGTATGG + Intronic
1136636686 16:31528807-31528829 CAGACCATGAAAGAGAAGCCAGG - Intergenic
1138299971 16:55917867-55917889 AAAAACTTGAGGGAGAAGTTTGG - Intronic
1139065516 16:63308461-63308483 TAAATTATGAAGGAGAAGTCAGG - Intergenic
1139172170 16:64645388-64645410 CAAAACATGAAGAGGAAGAAAGG + Intergenic
1139677255 16:68532398-68532420 CAAGGCATGAAGGGGAAGTGAGG + Intronic
1142055412 16:87992208-87992230 CAATACATGTAGATGAAGTCAGG - Intronic
1142276078 16:89119570-89119592 CAAAACATAAAGGAGGAGAAAGG + Intronic
1143210523 17:5183919-5183941 CAAAACTTCAAACAGAAGTCAGG - Exonic
1143436890 17:6935594-6935616 CAAAACAAGAACTAGAACTCTGG - Intronic
1143877472 17:10003103-10003125 CGTAACATGAAGCAGAAGGCTGG + Intronic
1144712220 17:17409332-17409354 AAAAAAAAGAAGGAGGAGTCAGG - Intergenic
1145352119 17:22092006-22092028 CAAAAAATGATGAAGAAGTTTGG + Intergenic
1146698089 17:34927098-34927120 AAAAAGAAGAAGAAGAAGTCTGG + Intergenic
1146949372 17:36894963-36894985 CAAAAAATCAAGGAGAGATCGGG + Intergenic
1147582488 17:41635214-41635236 CAAAACAGGAAGCAGAGGTGGGG + Intergenic
1147880093 17:43647806-43647828 GGAAACAGGAAGAAGAAGTCTGG + Intronic
1149098246 17:52870962-52870984 CAAAACAAGAAAGCGAAGTAAGG - Intronic
1151505612 17:74525155-74525177 CAAGGCATGGAGGAGAAGCCAGG + Intronic
1153355801 18:4133995-4134017 TAAAAAAAAAAGGAGAAGTCAGG + Intronic
1153410199 18:4783807-4783829 CTAAAGATGAAGGGGAAGTAAGG - Intergenic
1154163662 18:11998190-11998212 CAAAACAAAAAGGAGAAGAAAGG + Intronic
1154390181 18:13930052-13930074 GACAACATGAAGGAAAAGTGTGG + Intergenic
1155189520 18:23416943-23416965 CAAAACATCAATTAGAAGGCTGG + Intronic
1157879520 18:51306737-51306759 TCAAACATGAAGGAGAAATAAGG + Intergenic
1158279856 18:55812670-55812692 AAAAACATGAAAAAGAAGACAGG + Intergenic
1158470063 18:57728364-57728386 TAAAAAAAGAAAGAGAAGTCAGG + Intronic
1160277348 18:77449641-77449663 GAGAACTTGAAGGAGAAGTGGGG + Intergenic
1164469821 19:28520601-28520623 CAAGAAATGCAGGAGATGTCAGG + Intergenic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166229732 19:41419428-41419450 AAAAATAAGAAGAAGAAGTCTGG - Intronic
1167431431 19:49457249-49457271 AGAAATATGGAGGAGAAGTCCGG + Intronic
925695767 2:6576902-6576924 CACAGCCTGAAGGAGAAGTTTGG - Intergenic
926010963 2:9407590-9407612 CAAAACATCCTGCAGAAGTCAGG + Exonic
926985219 2:18615243-18615265 CAAAACATGAAAAATATGTCAGG + Intergenic
928211839 2:29329303-29329325 GACAACAGGAAGGAGAAGGCTGG + Intronic
928673656 2:33628477-33628499 TAAGACACGAGGGAGAAGTCTGG - Intergenic
928730195 2:34223213-34223235 CAAAGAATGAAGCAAAAGTCCGG - Intergenic
929213222 2:39382512-39382534 AATAACATGAAGGTGAAGACAGG + Intronic
930184624 2:48400425-48400447 AAAAATATGAAGGACAAGTTTGG - Intergenic
930494698 2:52126538-52126560 CAAAACTTCAAGGAGAGGTGGGG - Intergenic
933585675 2:84177363-84177385 CAAATCATGAATGAGAATTTGGG + Intergenic
933625640 2:84595590-84595612 TAAAACATAAAGTAAAAGTCAGG - Intronic
935650185 2:105375408-105375430 TAAAGAATGAAGGAGAGGTCAGG + Intronic
936384619 2:112017831-112017853 TAAAACAGGAAAGAGAAGTTGGG + Intronic
936542357 2:113362586-113362608 GAAAATATGAAGGAAAAGGCAGG - Intergenic
936915961 2:117639324-117639346 CATTGAATGAAGGAGAAGTCAGG - Intergenic
937102632 2:119283384-119283406 CAAAGCAGGAAGGAGGAGGCAGG - Intergenic
939052577 2:137325894-137325916 CAACACATGAATGAGAAGTTTGG - Intronic
939090014 2:137769376-137769398 CAAAACATGAAAGAGAAAGTGGG - Intergenic
939452456 2:142391787-142391809 CAAAACAAGAAGTAGCAGACAGG + Intergenic
940464674 2:154013401-154013423 CAAAACTTTAAGGAGAATGCTGG + Intronic
941145902 2:161844975-161844997 CAAAGCATGAATGAGATGTGAGG - Intronic
941305149 2:163855322-163855344 CAAAACTTGAAGCAGAAGTTAGG + Intergenic
942367341 2:175241349-175241371 CAAAAAAAGAAGTAGAAGTGGGG - Intergenic
942686440 2:178537550-178537572 CATAACATGAAGCCGAAGTGTGG + Exonic
942832257 2:180251152-180251174 TAAAAATTGAAGGAGAAGGCTGG + Intergenic
944099313 2:196005333-196005355 CAAAACAAGAAGGAGAAGGGAGG + Intronic
944512388 2:200477476-200477498 GAAAACATGAAGATGAGGTCAGG - Intronic
945422938 2:209661068-209661090 AAACACATGAAGGAAAAGTTTGG + Intronic
946930969 2:224670757-224670779 CAGACCATGAAGGAGAACTGAGG - Intergenic
947316761 2:228867048-228867070 AAAAACAAGAAGGAGCAGTGTGG - Intronic
947681798 2:232040536-232040558 CAAAAGATGAAAGACAAGTATGG - Intronic
948546697 2:238737155-238737177 TAAAACGTGAAGGAGAAATAAGG - Intergenic
1172971400 20:38875522-38875544 CAAAACAAAACAGAGAAGTCTGG - Intronic
1173826047 20:46048167-46048189 CAAAGCAAGCAGGATAAGTCAGG - Intronic
1174100859 20:48125217-48125239 CAACACAGGGAGGAGAGGTCTGG - Intergenic
1176175834 20:63723683-63723705 TAATACATGAAGGAGAAGAGGGG - Intronic
1176648889 21:9528353-9528375 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1177201136 21:17957443-17957465 CAAAACATGGAGGAGAATAGAGG - Intronic
1177241313 21:18461832-18461854 TAAAACATGAAGTTGAACTCAGG - Intronic
1178073698 21:28996030-28996052 AAAAACTTGAAGGACAAGACTGG + Intergenic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179588705 21:42390737-42390759 AAAAACAAAAAGGAGAAATCAGG + Intronic
1180927695 22:19567467-19567489 CAGAACTTGAAGGATAAGACGGG + Intergenic
1181106197 22:20577233-20577255 GTAAACAAGAAGGAGAAGCCAGG - Intronic
1181146686 22:20853450-20853472 GAAATCAGGAAGGAGGAGTCTGG + Intronic
1181868796 22:25881397-25881419 CAAGACATGAATGAGACATCAGG - Intronic
1181873929 22:25925131-25925153 CAAGACACTAAGGAAAAGTCTGG - Intronic
1182026311 22:27121953-27121975 CTAGACATGAATGAGAAGTAGGG - Intergenic
1185304731 22:50108318-50108340 CAACACATGCAGGAGAAGCCTGG - Intronic
950694579 3:14688658-14688680 CTAAAAATAAAGGAGCAGTCTGG - Intronic
951605781 3:24433437-24433459 CAAAAAATCAAGGAGATGTGTGG + Intronic
952044422 3:29301516-29301538 CAAAACAGGAAGTGGATGTCAGG - Intronic
952069792 3:29620386-29620408 CAATATATGAAAGAGAAATCAGG - Intronic
952075426 3:29690682-29690704 CAGAACTTGAAAGAGAATTCTGG - Intronic
956246674 3:67191198-67191220 CAAAACCACAAGGAGAAGTAGGG - Intergenic
956852081 3:73238139-73238161 CCAAACATGAATGAAAACTCAGG - Intergenic
958083453 3:88775792-88775814 TAAAAAATGAAGCAGAAATCTGG + Intergenic
962088875 3:132221999-132222021 AAAAACATTAAATAGAAGTCAGG + Intronic
965986117 3:174755211-174755233 CAGAAGATGAAGGGGAAGCCAGG - Intronic
966333522 3:178841589-178841611 CAGAAAATGAAGGAGAAGCAAGG + Intronic
966562215 3:181335535-181335557 CAAAACATGAGGGAGTAGTTGGG - Intergenic
967756689 3:193178221-193178243 GAAAAGAAGAAGAAGAAGTCAGG - Intergenic
969686701 4:8679472-8679494 CACAACAGAATGGAGAAGTCCGG - Intergenic
969991733 4:11271402-11271424 CAAAGCAGGCAGGAGAAGACGGG - Intergenic
971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG + Intergenic
973093045 4:46162333-46162355 GAAGACATAAAGGAGAAATCAGG + Intergenic
974469858 4:62304271-62304293 TCAAACATGAAGGAGAAATAAGG + Intergenic
974737012 4:65948746-65948768 TAAAATAAGAAGGAGAGGTCGGG - Intergenic
974813751 4:66979985-66980007 TAAAACCTGAAGGAGAATTGTGG + Intergenic
975695872 4:77012422-77012444 CAACACATGAAGGAAGAGACTGG + Intronic
975943179 4:79672840-79672862 CAAAGCAAGAAGGACAAATCTGG + Intergenic
976892922 4:90072564-90072586 CAAAACATGCAAGACAAGTCAGG - Intergenic
977704751 4:100058724-100058746 GAAAAGTTGCAGGAGAAGTCAGG - Intergenic
977876227 4:102153782-102153804 CAAAGCATTAAGGAGAAATGTGG - Intergenic
980469271 4:133230320-133230342 CAAAACAAGAAATAGAAGCCAGG + Intergenic
980721519 4:136702646-136702668 CAAAATATAAAAGATAAGTCTGG + Intergenic
981216748 4:142178652-142178674 AAAAACAAGAAGGAAAAGACAGG + Intronic
981842433 4:149128091-149128113 CTAAAAATAAAGGAGAAATCAGG + Intergenic
982403422 4:154994260-154994282 CACAATATTAAAGAGAAGTCTGG - Intergenic
984398534 4:179230761-179230783 GAAGACGTGAAGGAGAAGTAGGG - Intergenic
984732823 4:183084283-183084305 CAAAGCAGGCAGGAGAAGTTGGG + Intergenic
985367607 4:189248881-189248903 CAAAACCTCAAAGAGAAGTATGG + Intergenic
986155725 5:5174177-5174199 TCAAACATGAAGGAGAAATAAGG - Intronic
986270162 5:6223141-6223163 TAAAAGATGGAGGAGAAGTGAGG - Intergenic
987192656 5:15494704-15494726 CAAAACATAAAGTTGAATTCTGG - Intergenic
988504506 5:31810148-31810170 GAAAAGATAAAGTAGAAGTCAGG - Intronic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
991647882 5:68819320-68819342 CAAAACAAGATAGAGAAGTGGGG + Intergenic
993745940 5:91596894-91596916 CAGAACATGAAGGGGAAGAAAGG - Intergenic
993931083 5:93941016-93941038 CAAAACATTAAAGATAGGTCAGG - Intronic
994327149 5:98461716-98461738 CAAAGAATGAAAGAGAATTCTGG + Intergenic
994580626 5:101637262-101637284 CAAAACATTAAGGAGATCTCTGG + Intergenic
995034682 5:107519962-107519984 CAAAGCATGAATGAGAAATCAGG - Intronic
995107161 5:108387708-108387730 AAAAAGGTCAAGGAGAAGTCAGG + Intergenic
995868167 5:116715147-116715169 CAAATCATGTAGGAGACGTAAGG - Intergenic
996240842 5:121199344-121199366 CAAAATATGAAGTAGATGTCAGG + Intergenic
997629021 5:135352525-135352547 CAAAGCTTGAAAGAGAAGACAGG - Intronic
998647135 5:144074803-144074825 CAAAAGGTGAAGGAGAAGCAAGG - Intergenic
998859165 5:146426118-146426140 CAAAACTTTAATGAGAATTCAGG - Intergenic
999162823 5:149518924-149518946 GAAAACAGGAAGGAGAGGGCTGG + Intronic
999187881 5:149726393-149726415 AAAAAAAAGAAGGAGCAGTCCGG - Intergenic
999787776 5:154907674-154907696 GAAAGCATGAAGGAGAACTCAGG - Exonic
1003670155 6:8149487-8149509 CAATACTTCAAGGAGAAGTATGG - Intergenic
1004764457 6:18709785-18709807 TAAAGCATCAAGGAAAAGTCAGG - Intergenic
1005037194 6:21567704-21567726 TTAAACATGAAGGAGAAATAAGG - Intergenic
1005149495 6:22732643-22732665 CAAAACCAAAAGGAGAGGTCAGG + Intergenic
1005261994 6:24070969-24070991 AAAAAGAAGAAGAAGAAGTCAGG + Intergenic
1005296160 6:24429352-24429374 TAAATCATAAAGGAGAAGTAGGG + Intronic
1006082275 6:31574524-31574546 GAGAAGATGAAGGAAAAGTCAGG + Intergenic
1006259975 6:32859540-32859562 CAAAATAAGAAAGAGAAGTCTGG - Exonic
1006279019 6:33032072-33032094 CATAAGATGAAGCTGAAGTCAGG - Intergenic
1006877871 6:37314347-37314369 CATAACGTGAAGGACAAGGCCGG - Intronic
1008152680 6:47974116-47974138 CAAATAATGAGGGATAAGTCAGG + Intronic
1008289944 6:49703259-49703281 CAAAACAAAAAGAACAAGTCTGG - Intronic
1008860963 6:56149832-56149854 CAAACACAGAAGGAGAAGTCAGG - Intronic
1010051083 6:71505134-71505156 CAGAACATGAGGGAGATCTCAGG + Intergenic
1010210574 6:73360059-73360081 CAAAAAACGACGTAGAAGTCCGG - Intergenic
1010706049 6:79112109-79112131 TAAGATGTGAAGGAGAAGTCAGG - Intergenic
1011271303 6:85582270-85582292 TCAAACATGAAGGAGAAATAAGG + Intronic
1013743069 6:113311912-113311934 CAAAACATGAAAGACAAATCTGG - Intergenic
1014502786 6:122213794-122213816 CAACACAAGACGGAGAAGCCAGG - Intergenic
1015447501 6:133324840-133324862 CAAAACTTGAAAGAAAAGACTGG - Intronic
1016046351 6:139484413-139484435 CAAATCATGAAAAAGAAATCTGG - Intergenic
1016559808 6:145383284-145383306 CAACACATGAAAGAGAAGGGTGG - Intergenic
1017887656 6:158612099-158612121 CAAAACATGAGTGTGAAGTTCGG + Intronic
1018029558 6:159831357-159831379 AGAAACTTGGAGGAGAAGTCGGG + Intergenic
1019703977 7:2488724-2488746 GAATACATGAAGGAGATGACTGG - Intergenic
1020866107 7:13564920-13564942 TAAAACAAGAATGAGAACTCAGG - Intergenic
1021803584 7:24332772-24332794 CAAAGCACAAAGGAGAAGTAGGG + Intergenic
1022220836 7:28311961-28311983 GAAGAAAGGAAGGAGAAGTCAGG - Intronic
1023431085 7:40091517-40091539 AAAAAAAAGAAGGAGAATTCTGG + Intronic
1023892327 7:44401998-44402020 CAGAACATGAGGGAGGAGTGTGG - Intronic
1025275403 7:57578424-57578446 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1026171105 7:67954657-67954679 GAAAATATGATGGAGAAGTGGGG + Intergenic
1027564453 7:79773923-79773945 CAAAACATGATGAAGAATTTGGG - Intergenic
1027729265 7:81849279-81849301 CAGAAGATGAAGGAGAAGCAAGG + Intergenic
1030603822 7:111617972-111617994 TTAAACATGAAGTAGAAGTAAGG - Intergenic
1031104293 7:117521843-117521865 CAAACCATGAAGGAAAGTTCAGG - Intronic
1031948064 7:127861812-127861834 TAAAACAGTAAGTAGAAGTCTGG + Intronic
1032331303 7:130983089-130983111 TAAATTATGAAGCAGAAGTCAGG + Intergenic
1032588178 7:133167339-133167361 AAAAACAGGAAGGAGAAGAATGG - Intergenic
1032633754 7:133683136-133683158 CACAAGGGGAAGGAGAAGTCAGG - Intronic
1034026393 7:147708739-147708761 CAAAAAAGGAAGGGGAAGTGAGG - Intronic
1035426336 7:158777568-158777590 CAGAAGATGAAGGGGAAGTGAGG - Intronic
1036021022 8:4846423-4846445 CAAAACCTCAAGGACAAGCCTGG - Intronic
1037333496 8:17768350-17768372 CAAAACATGAATAAGAGATCTGG + Intronic
1037637205 8:20710779-20710801 CCGACAATGAAGGAGAAGTCAGG + Intergenic
1037839898 8:22237227-22237249 GGAAACATCATGGAGAAGTCGGG + Intergenic
1038093167 8:24277434-24277456 CAAAGCATGCAGGAGAACACTGG - Intergenic
1038200196 8:25405103-25405125 CAAAAGATAAAGGAGAAATTAGG - Intronic
1039129779 8:34249914-34249936 CAAAACAGAAAGGTTAAGTCAGG + Intergenic
1041041623 8:53852024-53852046 CAGAAAATGAAGGAGACCTCAGG + Exonic
1041071438 8:54129348-54129370 CAAAAGAATAAGGAAAAGTCAGG + Intergenic
1041766078 8:61419602-61419624 CAAAAGGTAAAGGAGAAGCCTGG - Intronic
1042077161 8:65008712-65008734 CAAAAGATGAAGGGGAAGCAAGG + Intergenic
1042372841 8:68012018-68012040 CAGAAGATGAAGCAGAAATCAGG - Intronic
1042519770 8:69699240-69699262 CCACACATAAAGGAGAAGTTCGG + Intronic
1042551259 8:69995879-69995901 CAAAACCTTGAGTAGAAGTCAGG - Intergenic
1042940184 8:74099517-74099539 CAAAAGATGAAGCAGATGACAGG - Intergenic
1045545960 8:103128516-103128538 CAAAACAGGAAAGAAAAGTTTGG - Intergenic
1046507192 8:115151433-115151455 AAAGAGATGAAAGAGAAGTCAGG - Intergenic
1046550005 8:115704144-115704166 AAAAACATTAAGTAAAAGTCAGG - Intronic
1047006077 8:120621817-120621839 CAAAACGTGGAGGAGATCTCTGG - Intronic
1047242799 8:123108448-123108470 TAAAGCATCAAGGACAAGTCTGG - Intronic
1050192611 9:3044077-3044099 CAAAGGATGGAGGAGAAGGCAGG - Intergenic
1050695978 9:8279484-8279506 CAAAAAATGAAGGGGATGCCAGG + Intergenic
1051980001 9:23002238-23002260 GAAAACTTGAAGGAGACCTCTGG - Intergenic
1052644912 9:31221559-31221581 CAAATCATGATGGACAAGTGAGG + Intergenic
1055171398 9:73263125-73263147 CAGAACATCATGGAGATGTCTGG + Intergenic
1057051260 9:91925914-91925936 CAAATCATGCAGGAGAAATTAGG - Intronic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1058536648 9:105967471-105967493 AAAAAAATGATGGAGGAGTCTGG - Intergenic
1058667482 9:107333792-107333814 TAAGACATGAAGCAGAAGTCTGG - Intergenic
1060470106 9:123941457-123941479 CATAACCAGCAGGAGAAGTCAGG - Intergenic
1060537811 9:124405496-124405518 CAAAAGTTGCATGAGAAGTCAGG + Intronic
1061870027 9:133515582-133515604 CAGAAGATGAAGGAGAAGAAGGG - Exonic
1062732470 9:138117833-138117855 CAACACATGCAGCAGAGGTCAGG - Intronic
1203626625 Un_KI270750v1:31902-31924 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1186065762 X:5762607-5762629 CAAAACAGGAAAGAGGAGCCGGG + Intergenic
1186169065 X:6858147-6858169 CAAAACATGGATAAGAACTCTGG + Intergenic
1186895803 X:14003507-14003529 CAAATCATTAAGGTCAAGTCAGG - Intergenic
1187932368 X:24305219-24305241 AAAAAGAAGAAGAAGAAGTCAGG - Intergenic
1189138255 X:38572841-38572863 CAAAATATGAAACAGAAATCTGG - Intronic
1189308270 X:40003511-40003533 GAAAACATGAAGGGGACGTGTGG - Intergenic
1191708819 X:64125066-64125088 CAAAAGATGAAAGATAAGTCTGG + Intergenic
1192208080 X:69109271-69109293 CAAGACATGAAGGGGCAGTTCGG + Intergenic
1192467500 X:71367602-71367624 TAAATGATGAAGGTGAAGTCTGG + Exonic
1192805029 X:74501220-74501242 CAAAACCTGAATCAGAAGCCTGG - Intronic
1193040929 X:77002703-77002725 AAAACCATCAAGTAGAAGTCTGG - Intergenic
1193534657 X:82699001-82699023 CAGAAGATGAAGGAGAAGCAAGG - Intergenic
1193850625 X:86532537-86532559 CAGAAGATGAAGGAGAAGCAAGG - Intronic
1194373495 X:93103907-93103929 CAATACAAGAAGGAGAAGGGAGG - Intergenic
1196108086 X:111917611-111917633 TGAATCTTGAAGGAGAAGTCAGG + Intronic
1197068502 X:122265122-122265144 TTAAACATGAAGGAGAAATAGGG - Intergenic
1199257994 X:145739052-145739074 CAGAAGGTGAAGGAGAAGGCAGG - Intergenic
1200681524 Y:6217951-6217973 CAATACAAGAAGGAGAAGGGAGG - Intergenic
1201056447 Y:9997194-9997216 GAAAACATGAGTGAGAAGTCTGG - Intergenic
1201528865 Y:14968812-14968834 TAAAACAGGAAGGAGGAGCCAGG - Intergenic
1202104234 Y:21345649-21345671 GAAAACATGAGTGAGAAGTCTGG + Intergenic