ID: 1091147729

View in Genome Browser
Species Human (GRCh38)
Location 11:133294587-133294609
Sequence GGATGCCTAAATTATCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091147729 Original CRISPR GGATGCCTAAATTATCAGCT TGG (reversed) Intronic
900856312 1:5187732-5187754 GGATGCCAAAACTATCTGCAAGG - Intergenic
906710873 1:47929121-47929143 GTATGTCTAAATTAACATCTAGG - Intronic
912758770 1:112347306-112347328 GGATGCCTATTTAATCAGCCTGG - Intergenic
913062021 1:115217117-115217139 GCATGCCCAAATGATGAGCTGGG + Intergenic
915582368 1:156822196-156822218 TGAAGCCCAAATTATCATCTGGG - Intronic
924182493 1:241453093-241453115 GCATGCCTAACTTTACAGCTTGG + Intergenic
1068562822 10:58535193-58535215 GGATGTCTAAATTTTTAGCAAGG - Intronic
1074811821 10:117112343-117112365 AGATGCATAAATGATGAGCTAGG - Intronic
1076056043 10:127373743-127373765 GGAAGCGTAAATAATCAGCATGG - Intronic
1079325952 11:19492836-19492858 GGATGCCTATATTTTCACCGAGG + Intronic
1085582074 11:77660902-77660924 GAATGGCAAAATTATCAGATGGG + Exonic
1087425107 11:97975703-97975725 GGATCCCAAAATTCTGAGCTAGG + Intergenic
1088553386 11:111037328-111037350 GGATGCCTAACTTACCAGCATGG - Intergenic
1091147729 11:133294587-133294609 GGATGCCTAAATTATCAGCTTGG - Intronic
1099740089 12:86623925-86623947 GGATGCCTCCATTTTCTGCTAGG - Intronic
1100103582 12:91140915-91140937 GGATGGCTGAATGATCAGATGGG - Exonic
1105881777 13:24612304-24612326 GGAAGCCCACATCATCAGCTTGG + Intergenic
1106158897 13:27183302-27183324 TGATGCTTAAATTTCCAGCTTGG - Intergenic
1109577892 13:64285729-64285751 GTATGCCTACCTTAACAGCTGGG - Intergenic
1110178715 13:72589496-72589518 TGATGCTTAAATTGTCATCTTGG - Intergenic
1114870784 14:26655559-26655581 AAATGCCTAAATTATTAACTAGG - Intergenic
1115436627 14:33382342-33382364 CGATACCTAAATTATTAGATTGG + Intronic
1119104424 14:71910760-71910782 AGATGCCCAAATTTCCAGCTTGG + Intergenic
1122509404 14:102254401-102254423 AGATTCCAGAATTATCAGCTTGG - Intronic
1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG + Intronic
1128747952 15:70127671-70127693 GGAGGCCTAGCTTCTCAGCTGGG + Intergenic
1131894690 15:97013544-97013566 CTATGCCTAAATTTTCTGCTAGG - Intergenic
1135637517 16:24091529-24091551 GGGAGACTAAATCATCAGCTTGG - Intronic
1144400287 17:14890917-14890939 GGATGCTTTAATTATCTGCGGGG - Intergenic
1144940856 17:18939307-18939329 GGATGCTGAAATTATCAGATAGG + Intergenic
1146250441 17:31337013-31337035 GGAGGCTTAAATTAGCAACTTGG - Intronic
1148383654 17:47219374-47219396 GGATTCCTAAATTCTCATCTTGG - Intronic
1150734218 17:67722528-67722550 GGATGCAAAAATCACCAGCTGGG - Intronic
1151984127 17:77531142-77531164 GGTTGGGTAAATAATCAGCTCGG + Intergenic
1153366022 18:4257258-4257280 GGATGCCTAAAGCATCAACATGG + Intronic
1155245719 18:23906931-23906953 GGATGGCAATATTATCAGCTAGG + Intronic
1157228917 18:45895175-45895197 TGATGCCTAAGTTTCCAGCTTGG + Intronic
1166467086 19:43042125-43042147 GGATGCTGAAATTATCAGACTGG - Intronic
1166473220 19:43098211-43098233 GGATGCTGAAATTATCAGACTGG - Intronic
927683059 2:25152908-25152930 GGATGCCCATGTTATGAGCTAGG + Intronic
933345724 2:81083215-81083237 AGCTGCCTCAATTATCAGATTGG - Intergenic
933629859 2:84643831-84643853 GGATGCTGAAATTATCAGACAGG - Intronic
933695060 2:85211590-85211612 TCTTGCCTAAATTATAAGCTAGG - Intronic
940305514 2:152221521-152221543 GGAGGCCTCAATCATTAGCTAGG + Intergenic
941329229 2:164157802-164157824 GTTTTCCTAAATGATCAGCTTGG + Intergenic
941363714 2:164584109-164584131 GGATGCCTATAGTCCCAGCTTGG - Intronic
947010119 2:225556469-225556491 AGATGCCTAAATTATCACCTGGG - Intronic
947057726 2:226126017-226126039 GGAAGACTAAATTATTAGCTTGG + Intergenic
1170778766 20:19404586-19404608 TCATGCCCAAATCATCAGCTAGG - Intronic
1176882200 21:14209665-14209687 AGTTGCCTAAATTTTCAGTTGGG - Intronic
1179131206 21:38638859-38638881 GGAACCCTAAATTACCTGCTAGG - Intronic
1182834636 22:33332097-33332119 GACTACCTGAATTATCAGCTGGG + Intronic
949633025 3:5949966-5949988 AGAAGCCTAAACTATAAGCTAGG - Intergenic
951294643 3:20918765-20918787 GGATGTCTAGATTATTAGCAAGG - Intergenic
955719096 3:61862973-61862995 TGATGCCTAAACTCTCATCTAGG + Intronic
961942614 3:130653954-130653976 GTGAGCCTAAATTATCAGCAGGG + Intronic
963822722 3:149916140-149916162 GGATGCCTATAAAATCATCTAGG + Intronic
965554640 3:170006385-170006407 GGATGACTGAATTTTTAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
980095213 4:128483010-128483032 GGATGCTTTAATAATCTGCTTGG - Intergenic
983845447 4:172512985-172513007 GGATGCCTAAATCTCCAGCAAGG + Intronic
985708281 5:1414111-1414133 GGATGCCGCAAACATCAGCTTGG - Intronic
995789851 5:115874426-115874448 ATATGCCTCCATTATCAGCTTGG - Intronic
999573017 5:152942149-152942171 GTATGCATAAAATATCTGCTTGG - Intergenic
999622466 5:153486993-153487015 GTATGCCAAAAATATGAGCTGGG + Intergenic
1003087567 6:3072972-3072994 GAATGCCAACATTCTCAGCTGGG - Intronic
1004326658 6:14681050-14681072 AATTGCTTAAATTATCAGCTCGG + Intergenic
1008419760 6:51284277-51284299 GGTTTCTTAAATTATCACCTGGG + Intergenic
1010917691 6:81641233-81641255 GGATGTCTAATTTATCAGAAAGG + Intronic
1011757164 6:90511868-90511890 GGCTGCCTAAAGTAACAGATGGG + Intergenic
1015884593 6:137903928-137903950 GGATTCCTTCATTCTCAGCTGGG + Intergenic
1018487288 6:164254101-164254123 GAATACCTAAATTATTATCTAGG + Intergenic
1020934934 7:14450974-14450996 AGATGCCCAAAATATCAGATGGG + Intronic
1028897397 7:96057516-96057538 AGATGCCTAAATTATCTACCAGG + Intronic
1034047775 7:147947922-147947944 GGAAGCCTAAATTATCTACAGGG - Intronic
1036835205 8:12058149-12058171 GTATGTCTTTATTATCAGCTTGG + Intergenic
1036857046 8:12304713-12304735 GTATGTCTTTATTATCAGCTTGG + Intergenic
1038099278 8:24354425-24354447 TAATGGCTAAATTATCAACTTGG + Exonic
1042615799 8:70647665-70647687 GGAAGCCTAAATAAGCAGCAGGG + Intronic
1046292289 8:112178854-112178876 TGCTGCCTAAAGTATCAGGTAGG - Intergenic
1054772649 9:69097408-69097430 GGATGGCAAAATTATTAGATTGG - Intronic
1054941711 9:70750272-70750294 GAAAGCCTAAATTATAGGCTGGG + Intronic
1186150240 X:6666851-6666873 GGATGCCAAAATGCTCAGTTTGG - Intergenic
1187700348 X:21959149-21959171 GCATGCCTTACTTAACAGCTTGG - Intronic
1193772989 X:85609699-85609721 TGATGCCTGACTTGTCAGCTTGG - Intergenic