ID: 1091148214

View in Genome Browser
Species Human (GRCh38)
Location 11:133299750-133299772
Sequence TAGGATGACCCTAATTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091148210_1091148214 7 Left 1091148210 11:133299720-133299742 CCTCCTAAGTAGATGAAGGGGTC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1091148214 11:133299750-133299772 TAGGATGACCCTAATTTGGATGG 0: 1
1: 0
2: 1
3: 4
4: 88
1091148211_1091148214 4 Left 1091148211 11:133299723-133299745 CCTAAGTAGATGAAGGGGTCAAA 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1091148214 11:133299750-133299772 TAGGATGACCCTAATTTGGATGG 0: 1
1: 0
2: 1
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091148214 Original CRISPR TAGGATGACCCTAATTTGGA TGG Intronic
902878729 1:19356803-19356825 TAGGATGACCCTGAATTCCAGGG - Intronic
904069740 1:27784931-27784953 TGGGATGACCTAAATTTGGGGGG - Intronic
907644746 1:56231136-56231158 TAGAATTACCATAATTTGGGAGG + Intergenic
908411386 1:63869202-63869224 CAGGATGTCCCTAATATGCATGG + Intronic
918114891 1:181487318-181487340 TAGGATCACCCCGACTTGGAGGG + Intronic
918299028 1:183185765-183185787 GAGGTTGACCCTAAACTGGAGGG + Intergenic
918981912 1:191572258-191572280 TAGGATAACTCTAATGTGTAAGG + Intergenic
1066552753 10:36577545-36577567 TAGGATGATCCTAATTTTTAAGG + Intergenic
1069098358 10:64287700-64287722 TAGGAGGAACATATTTTGGAAGG - Intergenic
1070489391 10:76962393-76962415 TAGGATGCCCTTAATTTGGATGG - Intronic
1075073467 10:119334540-119334562 TAGGATGTCCGAAACTTGGAAGG + Intronic
1084379069 11:68799154-68799176 TATGAAGACGCTAATTTTGAGGG - Intronic
1086398649 11:86442806-86442828 TAGGATGCCCCTTACTTTGATGG + Exonic
1090988973 11:131799211-131799233 TAGGATGAGCCTAATTAGAGTGG - Intronic
1091148214 11:133299750-133299772 TAGGATGACCCTAATTTGGATGG + Intronic
1091752470 12:3031485-3031507 TAGGATGGTCCTTATCTGGAGGG - Intronic
1098292889 12:68975033-68975055 TAGAATCACCCTATTTTGAAAGG - Intergenic
1100482159 12:94989587-94989609 TTTGATGACCCTTATTTGTATGG - Intronic
1104808717 12:131606623-131606645 TAGGCTGAGCTTACTTTGGAAGG - Intergenic
1106370600 13:29128953-29128975 AAGGATGACCCTAGTTTAAAAGG + Intronic
1120463972 14:84832365-84832387 TAGGAAGAGCCAAATTTGAAGGG - Intergenic
1121147625 14:91598948-91598970 TAGGATGAACTAACTTTGGAAGG + Intronic
1124724904 15:32148125-32148147 CAGGATGACCCTAAATAGTAAGG - Intronic
1125653767 15:41339073-41339095 TAGTTTGACCCTGATTTGGAGGG + Intronic
1126438864 15:48665367-48665389 TGGGACCACCCTAATGTGGATGG + Intergenic
1126801737 15:52304170-52304192 TAGGATGACCCTAGCTAGGATGG - Intergenic
1131598754 15:93826308-93826330 TGAGTTGACTCTAATTTGGAGGG - Intergenic
1137869510 16:51936086-51936108 TGGGATGACTCTAATGTGGCTGG - Intergenic
1140401150 16:74672801-74672823 TAGGAGGACCCTAGGTTGTAAGG + Intronic
1147716538 17:42512512-42512534 TAGGATTACCCTAGTTTTCAGGG + Intronic
1148583772 17:48762210-48762232 GAGGAGGAGCCTGATTTGGAGGG - Intergenic
1149515268 17:57276380-57276402 GAGCATGACTCTGATTTGGAGGG + Intronic
1151834644 17:76574650-76574672 AAGGATGGCCCCAATCTGGAGGG - Intronic
1153583260 18:6596725-6596747 TAGGAGGTCCCTAATGTCGAAGG + Intergenic
1157008968 18:43623354-43623376 TAGAATGTCACTAATTTGAAAGG - Intergenic
1158385559 18:56986770-56986792 TAGAACAACACTAATTTGGAGGG - Intronic
1161825843 19:6564662-6564684 TAGGATCACTCCAGTTTGGATGG - Intergenic
1163939308 19:20477847-20477869 GAGGATGTCTCTACTTTGGAGGG + Intergenic
1165822558 19:38685784-38685806 TAGGATGGCCCTGACTTGGCCGG + Intronic
925446228 2:3929141-3929163 TAGGATGCCTCTAAGTTTGAAGG + Intergenic
925935133 2:8750258-8750280 TAGGAGGACCCTCATGTAGAGGG + Exonic
929847686 2:45547443-45547465 TTTGAAGCCCCTAATTTGGAGGG - Intronic
933469432 2:82702471-82702493 TAGCAAGACCCTGATTTTGAAGG + Intergenic
933906150 2:86895228-86895250 TAGGTGGGTCCTAATTTGGAGGG + Intergenic
935407920 2:102728533-102728555 AAGGATGACAGTATTTTGGAAGG - Intronic
935766994 2:106378406-106378428 TAGGTGGGTCCTAATTTGGAGGG + Intergenic
936050495 2:109219054-109219076 TTAGCTGACCTTAATTTGGATGG + Intronic
936079495 2:109422754-109422776 TAGGTTGCCCCTGATTTTGAAGG + Intronic
936366013 2:111856431-111856453 TAGGTGGGTCCTAATTTGGAGGG - Intronic
939714635 2:145568784-145568806 CAGGATTACCCTAAATTGAAGGG - Intergenic
941711858 2:168723025-168723047 TTTAATGACCCTATTTTGGAGGG + Intronic
1173064958 20:39701875-39701897 AAGGATGACATGAATTTGGAAGG + Intergenic
955071831 3:55578087-55578109 GAGGATGGCCCTAAGTGGGAAGG - Intronic
955083171 3:55676652-55676674 ACAGATGACACTAATTTGGAAGG - Intronic
955583110 3:60446336-60446358 TAGGATGAACCTTCTTTGGTGGG - Intronic
956238806 3:67106234-67106256 TAGTATGGCCCTAATTTGTGGGG + Intergenic
956396842 3:68834959-68834981 TAGGATGACCATATATTAGAGGG - Intronic
957798749 3:85047148-85047170 TATGATGACAGAAATTTGGATGG - Intronic
960143116 3:114170472-114170494 TAGGATAATCCTAGTTGGGAGGG - Intronic
971108957 4:23560984-23561006 GAGGACAGCCCTAATTTGGAGGG + Intergenic
972248146 4:37268157-37268179 TAGGATGACCCCAAATTTGTAGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976909732 4:90287212-90287234 TTGGCTGACCCTATTTTGTAGGG - Intronic
977300715 4:95264196-95264218 TAGGATGACCCTATTTTTGTTGG - Intronic
984069738 4:175095310-175095332 TAGCATGACTCTGATTTTGAGGG - Intergenic
984577914 4:181472802-181472824 TAGGATGGACATAATTAGGAGGG - Intergenic
985426318 4:189834544-189834566 TAGGGTTACCCTCATTTGGCTGG - Intergenic
986314337 5:6576283-6576305 TCAGGTAACCCTAATTTGGACGG + Intergenic
989219234 5:38936558-38936580 AAGGTTGACCCTAATTAGTATGG - Intronic
993514494 5:88813882-88813904 TATCATGACTCTTATTTGGAGGG - Intronic
1002125612 5:177041403-177041425 TATAATGATCCTGATTTGGATGG - Intronic
1002486605 5:179542254-179542276 TAGGATGCCAGTCATTTGGACGG + Intergenic
1002605059 5:180378108-180378130 TAGGATGAGCCCAGTTTGGTTGG - Intergenic
1003077547 6:2996516-2996538 TAGGATGGCTATAATTTAGAGGG + Intronic
1005937865 6:30537674-30537696 TAGAAGGACCCTACTTTGGCCGG + Intergenic
1007315892 6:40988674-40988696 TAGCATGAGACTAATTTGAAGGG + Intergenic
1009395210 6:63191891-63191913 AAGGCTGACCCAAATTGGGAAGG + Intergenic
1010831503 6:80536191-80536213 GAGGATGACCCAAATGTGTAAGG - Intergenic
1014783937 6:125596722-125596744 GAGGATAATCCTAATTTGGCAGG - Intergenic
1022792628 7:33704075-33704097 GAGGATGAGACTCATTTGGATGG + Intergenic
1026212197 7:68315558-68315580 TAGGTTGACGCTAGTTTGTAGGG - Intergenic
1026388722 7:69878256-69878278 TAGGAGAACCCTAAGGTGGAGGG + Intronic
1028764251 7:94532969-94532991 CAGGATGACAGAAATTTGGATGG - Intronic
1039597712 8:38805885-38805907 AAGGATGCCACAAATTTGGAAGG - Intronic
1044062632 8:87657660-87657682 AATGATTACTCTAATTTGGAAGG - Intergenic
1048822019 8:138389122-138389144 TAGGATGGCCATAATTTAAATGG + Intronic
1051219532 9:14833385-14833407 TAGGCTGAACCGACTTTGGAAGG - Intronic
1051482096 9:17572238-17572260 TAAGATGCCCTTAACTTGGAAGG - Intergenic
1053824702 9:42010283-42010305 CAGAATGACCCAAACTTGGAAGG + Intronic
1054605869 9:67177080-67177102 CAGAATGACCCAAACTTGGAAGG - Intergenic
1057766378 9:97922849-97922871 CAGTATGACCCTAATTTTTAAGG + Intergenic
1185912800 X:4000886-4000908 CAGGATGACTCTAATATGAAGGG + Intergenic
1195363025 X:104103420-104103442 TATGATGACCATATTTTGAATGG + Exonic
1197280518 X:124530150-124530172 TAGTATGATTCTAATTTTGATGG - Intronic