ID: 1091150171

View in Genome Browser
Species Human (GRCh38)
Location 11:133321041-133321063
Sequence CTCAGCCATGTCTTCATGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091150166_1091150171 11 Left 1091150166 11:133321007-133321029 CCAGCTCCTCTTCTTAAGGAGAC 0: 1
1: 0
2: 4
3: 18
4: 279
Right 1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG 0: 1
1: 0
2: 1
3: 14
4: 143
1091150163_1091150171 14 Left 1091150163 11:133321004-133321026 CCCCCAGCTCCTCTTCTTAAGGA 0: 1
1: 0
2: 1
3: 28
4: 262
Right 1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG 0: 1
1: 0
2: 1
3: 14
4: 143
1091150167_1091150171 5 Left 1091150167 11:133321013-133321035 CCTCTTCTTAAGGAGACTTTAAC 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG 0: 1
1: 0
2: 1
3: 14
4: 143
1091150164_1091150171 13 Left 1091150164 11:133321005-133321027 CCCCAGCTCCTCTTCTTAAGGAG 0: 1
1: 0
2: 0
3: 27
4: 290
Right 1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG 0: 1
1: 0
2: 1
3: 14
4: 143
1091150165_1091150171 12 Left 1091150165 11:133321006-133321028 CCCAGCTCCTCTTCTTAAGGAGA 0: 1
1: 0
2: 0
3: 27
4: 243
Right 1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG 0: 1
1: 0
2: 1
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091150171 Original CRISPR CTCAGCCATGTCTTCATGTA CGG Intronic
901763570 1:11486174-11486196 CTCAGCTGTGTCTACATGGAAGG - Intronic
902199449 1:14822815-14822837 TGCAGCCCTGTCTTCATGTGTGG - Intronic
903729159 1:25477631-25477653 CTCAGCCAAGACTTCACCTAGGG - Intronic
905226548 1:36482711-36482733 CTCTGCCAAGTGTTCATGTCCGG - Intronic
905335462 1:37241580-37241602 CTGAGCCATATCCTCATGTGTGG - Intergenic
906585070 1:46968478-46968500 CTCAGCCATCTCTACATGTATGG - Intergenic
910383439 1:86656753-86656775 CTCTGGCATGTCTTCGTTTACGG - Intergenic
910551202 1:88477501-88477523 CTCAGGCTTCTCTTCTTGTAAGG - Intergenic
910576394 1:88769650-88769672 CTCACCCATGTTGTCATATATGG - Intronic
912006505 1:104908491-104908513 CACAGTGATGTCTTCGTGTATGG - Intergenic
913523123 1:119665230-119665252 GTGAGCCTTGTCTTTATGTAAGG + Intronic
915068643 1:153246943-153246965 CTCAGCAATCTCTTCCTGGAAGG + Intergenic
917650667 1:177074047-177074069 TTTAGCCATGACTTCATGTAGGG + Intronic
920594802 1:207258696-207258718 CTAAGCCATGTCTGCATTAAGGG + Intergenic
921408037 1:214802716-214802738 CTCAGCTATATCTCCTTGTAAGG + Intergenic
923847791 1:237756196-237756218 TTTAGTCATCTCTTCATGTATGG - Intronic
1064261736 10:13791707-13791729 ATCATCCATGCCTTCATTTATGG - Intronic
1064332093 10:14403516-14403538 CTCAGCCACGTCTTCGCATAAGG + Intronic
1070321618 10:75358890-75358912 CTCAGGCATGGCTTCGTGTTGGG - Intergenic
1070480575 10:76878684-76878706 CTCAGCCATTTCTGTATTTAGGG - Intronic
1072281411 10:93869086-93869108 CTGGGCCATATCTTCATCTATGG - Intergenic
1075266447 10:121003044-121003066 CTCAGCCTTGGCTTCCTGTTTGG - Intergenic
1075442381 10:122490409-122490431 CTTAGCAAAGTCTTCATGTCTGG + Intronic
1078457494 11:11486634-11486656 GTCAGACATATCTTCATGGAGGG - Intronic
1081487612 11:43543963-43543985 TTCAGGCATGGCTTCATATAGGG - Intergenic
1081890910 11:46541974-46541996 CTCAGGCATATCCTGATGTAAGG + Exonic
1082654276 11:55834172-55834194 CTCAGCAATGTTTTGCTGTATGG + Intergenic
1083261014 11:61523250-61523272 ATCAGCCATACCTTCACGTAGGG + Exonic
1086053040 11:82616498-82616520 CTCAGCATTGGCTGCATGTAGGG - Intergenic
1089025590 11:115266239-115266261 CTCAGCCATGTCTTAACATTAGG + Intronic
1089990243 11:122852661-122852683 CTCAGCGTTGTCTTTTTGTAAGG + Intronic
1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG + Intronic
1096422257 12:51468957-51468979 TTCAGCCATGACTTCAGGCAGGG - Intronic
1096909169 12:54964839-54964861 CTCAACCATGGCTACATGTTAGG + Intronic
1101811826 12:108113937-108113959 CACAGCAATGTCATCACGTAGGG - Intergenic
1104734199 12:131126874-131126896 CTCATCCATGCCTTGCTGTATGG - Intronic
1105714802 13:23052448-23052470 CTGAGCCATCTCTTCCTGTAAGG - Intergenic
1106206524 13:27601412-27601434 CTCAGCAATGTCTGCAGATAGGG - Intronic
1106563595 13:30867201-30867223 TTTTGCCATGTTTTCATGTAGGG + Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1110687082 13:78388063-78388085 CTGAGTCATGTCTTCATCTGAGG - Intergenic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1120649810 14:87118712-87118734 CTAAGCAGTCTCTTCATGTAAGG - Intergenic
1121089128 14:91169181-91169203 CTGAGCCATGCCTTCATGCCGGG - Intronic
1121619194 14:95334432-95334454 CTCACCCCTTTCTTCATGAAAGG + Intergenic
1122422107 14:101584133-101584155 CTCAGCCATGTCTGCAGATCCGG + Intergenic
1126317897 15:47390338-47390360 CTCAGCTATGTCTTTAGTTAAGG - Intronic
1129319948 15:74768946-74768968 CCCAGCCCTGTCCTCATGTCAGG + Intergenic
1131629898 15:94165605-94165627 CCCAGCCATTTCTGCATTTATGG - Intergenic
1131960814 15:97788560-97788582 CTCTGGCATGTCTTCTTATAAGG - Intergenic
1137448349 16:48546880-48546902 CTCATCCATGTATGCATGGAGGG - Intronic
1138047488 16:53740833-53740855 TTCAGCCTTGTCTTAATTTATGG - Intronic
1140227925 16:73093561-73093583 CTCGGCCTTGTCTTCATCTTGGG + Intergenic
1141983221 16:87562523-87562545 CACAGCCCTGTCTGCATGCAGGG + Intergenic
1145006484 17:19341507-19341529 CTGAGGCATGTCCTCAGGTAGGG + Intronic
1146791392 17:35752731-35752753 CTCAGCCAGGTCTTCCTTCATGG + Exonic
1150337738 17:64342639-64342661 CTCAGCCCTGTCTGCATATTAGG - Intronic
1151544625 17:74785266-74785288 GTCATCCATGTGTTCATGTTTGG + Intronic
1152253053 17:79221686-79221708 CTCAGCCAGGTCCCCATGGAAGG - Intronic
1156151089 18:34243779-34243801 CTCTGCCAGGTTTTCATGTCAGG + Intergenic
1157125658 18:44953324-44953346 CTCCTCCATGTCTCCAGGTAAGG + Exonic
1158261096 18:55606543-55606565 CTCAGCAATGTTTTCATCTGTGG + Intronic
1158628493 18:59091964-59091986 CTTTGCCCTGTCTTCATGTCCGG + Intergenic
1159863375 18:73675376-73675398 TTCACCCATGTCTTCATCTTTGG + Intergenic
1163959947 19:20680150-20680172 CTCATCCATGTCCTGATATAAGG - Intronic
1165088291 19:33366841-33366863 CTCCAGCATGTCTTCATATAAGG - Intergenic
1167713207 19:51124862-51124884 CTCGCCCCTGTCTTCCTGTAGGG + Intergenic
925871029 2:8270721-8270743 TTCAGTCAGGTCTTCATGAAAGG - Intergenic
929342946 2:40844998-40845020 CTCAGCCATTTTTAAATGTAAGG + Intergenic
929554808 2:42919504-42919526 CACAGCCCTGTCTACATGGAAGG - Intergenic
929678864 2:43967933-43967955 CTTAGCTATGTCATCATGTCAGG - Intronic
930583319 2:53239424-53239446 CTTAGACATGCCTTCATGTAGGG - Intergenic
930736587 2:54786227-54786249 CTCTGCCCTGTCTTCAAGGAGGG + Intronic
932317127 2:70792262-70792284 CCCAGCCATGCCTTCATGGAGGG + Intergenic
932473972 2:71989038-71989060 CTCAGCCATCTCCTTATTTATGG - Intergenic
941992975 2:171575104-171575126 TCCAGCCATCTCTTCTTGTAGGG + Intergenic
945220806 2:207482026-207482048 CTCAGCCATGTGTTTATGCCAGG - Intergenic
945758598 2:213882308-213882330 CTCTGCCATGTTTTCATATTAGG + Intronic
947822133 2:233079497-233079519 CTCAGCCAGGCCTTCACGTCCGG - Intronic
948102259 2:235384564-235384586 CTCAGCCTCCTCTTCATGGAGGG + Intergenic
1170148731 20:13205764-13205786 CTCTGCCTTGTCATCAAGTAGGG + Intergenic
1171083892 20:22218014-22218036 CTGAGCCATGTCTGCATGCTTGG + Intergenic
1172190098 20:33056720-33056742 CAAAGCCAAGTCTTCCTGTAGGG - Intronic
1173791014 20:45827731-45827753 CTGAGCCATTTCTTCATCTGTGG + Intronic
1174095694 20:48087953-48087975 CTCAGCCCTGCCTTCCTGTTTGG + Intergenic
1175462093 20:59159445-59159467 CTCAGCGATGTTTTTATTTAAGG - Intergenic
1176094917 20:63336202-63336224 TTCAGCCTTGTCTTCATCCATGG - Intergenic
1176340700 21:5692659-5692681 CTCAGCCATCTCGTCATATTGGG - Intergenic
1176472954 21:7124812-7124834 CTCAGCCATCTCGTCATATTGGG - Intergenic
1176504127 21:7631797-7631819 CTCAGCCATCTCGTCATATTGGG + Intergenic
1177427617 21:20944652-20944674 CTGAGCCAATTCTTCATGTAGGG - Intergenic
1178110290 21:29363370-29363392 CTCATCCATGTCATTATTTATGG - Intronic
1178978455 21:37240897-37240919 CTCAGACATGTCTTCATTCCTGG + Intronic
1179044312 21:37831061-37831083 CTGAGCCATGTCTCCATGCAAGG - Intronic
1180816875 22:18795357-18795379 CTCAGCCCTGCCTCCATTTATGG - Intergenic
1182722084 22:32411433-32411455 CTCAGCCAGGACTTGATGTCCGG - Intronic
1182938316 22:34248326-34248348 CTCAGCCATTTCTTTATTGATGG + Intergenic
1203223856 22_KI270731v1_random:65722-65744 CTCAGCCCTGCCTCCATTTATGG + Intergenic
1203239964 22_KI270733v1_random:7117-7139 CTCAGCCATCTCGTCATATTGGG - Intergenic
1203266974 22_KI270734v1_random:21078-21100 CTCAGCCCTGCCTCCATTTATGG - Intergenic
951436530 3:22671187-22671209 CTCAGCAATCTCTTCATTCATGG - Intergenic
952679171 3:36071490-36071512 CTCTGCCAGGTTTTCATGTCAGG + Intergenic
952886592 3:38016185-38016207 CTCTGCCATCTCTTCTTGTAAGG - Intronic
953790165 3:45941281-45941303 CTCTGCCAGGTCTTCAGGTAAGG + Intronic
955109081 3:55929816-55929838 CGCAGGCATGTCTTCTTATATGG - Intronic
958534881 3:95387592-95387614 CTCAGCCATGACTTCCTCCATGG - Intergenic
958815305 3:98907779-98907801 CCCAGCAATGTCTTAATGAATGG + Intergenic
965266811 3:166554052-166554074 CTCATCCATGTTTTCATAAATGG - Intergenic
965907073 3:173722061-173722083 CTCAGAGGTGTCATCATGTAAGG - Intronic
970641279 4:18069146-18069168 TTCAGCCATGTGGTGATGTAAGG + Intergenic
973786069 4:54333805-54333827 CTCAGCAATGTCTGAATGAAGGG + Intergenic
977376718 4:96214407-96214429 CTCAGCCAACACTTCATATATGG + Intergenic
978207875 4:106101285-106101307 CTGAGCAATGTCTTCATGTCTGG - Intronic
979722881 4:123923017-123923039 CTTTGCCATGTCTGCATGTGTGG + Intergenic
988452419 5:31356616-31356638 CTCTGCCATCTCTTCTTATAAGG + Intergenic
988709146 5:33756099-33756121 ATCAGCCTTGTCTTCATGGCTGG - Intronic
1000580782 5:163033471-163033493 CTCAGCCCTCTCTCCATGTGAGG + Intergenic
1001891668 5:175344467-175344489 CTCAGCCAAGTCTTGATGTTCGG + Intergenic
1004988997 6:21115912-21115934 CTCAGCTATGTCTGCATCTTTGG - Intronic
1013412357 6:109893310-109893332 TTCAGCCATGTATTAATATAAGG + Intergenic
1015777469 6:136828801-136828823 CTCAGCCATGTCTTAGTGTTAGG + Intronic
1017995702 6:159530008-159530030 CACAGCAATGACTTCATGCAGGG - Intergenic
1022835168 7:34106467-34106489 CTGAGCCCTGTCTACATGCAGGG - Intronic
1023394924 7:39743817-39743839 CTCAGGAATGTCTTCATTTTGGG - Intergenic
1024290871 7:47802769-47802791 CACAGCCAAGTCTTCATCCAGGG - Intronic
1031978054 7:128106161-128106183 ATCAGCCATGACTTCATGGCAGG - Intergenic
1032223925 7:130015369-130015391 CTCAGCAATGACTTCATGATTGG - Intergenic
1032478147 7:132226259-132226281 CTCAGCCATCTCTCCTTGTAGGG - Exonic
1035077054 7:156186864-156186886 CTCACCCCTGCCATCATGTAAGG + Intergenic
1037325165 8:17681677-17681699 CTCCTCCATCTCTTTATGTACGG + Intronic
1039297345 8:36170667-36170689 CTCAGCAATGTCTTCCTATTGGG - Intergenic
1039527580 8:38230815-38230837 CTCAGTTATGTCTTCCTGTTTGG + Intronic
1039800884 8:40953462-40953484 CCCAGCCATGTCTTCAAGGAAGG + Intergenic
1044864585 8:96557983-96558005 CTAACCCATGTCTACATTTAGGG + Intronic
1045101524 8:98849437-98849459 CTCACCCAGTTCTTCATGTTAGG + Intronic
1045820777 8:106335506-106335528 CTCAGACATTTCTCCATGGAAGG + Intronic
1046591901 8:116216960-116216982 CTCAGCCAAGTCTTGAAATATGG - Intergenic
1048960665 8:139574082-139574104 CTAAGCCCTGTCCTCATGCAGGG + Intergenic
1049030438 8:140032718-140032740 TTCAGAAATATCTTCATGTATGG - Intronic
1049678212 8:143902942-143902964 CTCAGCCTGGTCTTCGTGAATGG + Intergenic
1050574552 9:6979789-6979811 TTCAGCCTTGTCTCCATTTACGG - Intronic
1051506680 9:17834700-17834722 CTGTGCCCTGTCTGCATGTAAGG - Intergenic
1054879184 9:70127104-70127126 TACAGACATGTATTCATGTACGG - Intronic
1056124080 9:83517656-83517678 CTCTGCCAGGTTTTAATGTAAGG - Intronic
1056702264 9:88920621-88920643 CTCAGCAATGCCTTCCTGTCAGG - Intergenic
1057403833 9:94749379-94749401 ATCAGCCATGTCTCCAAGGAGGG + Intronic
1058491396 9:105504140-105504162 CTCTGCTATGCCTACATGTAAGG - Intronic
1061275024 9:129565026-129565048 CTCAGCCAGGTCTTCCAGTGTGG - Intergenic
1203422367 Un_GL000195v1:5334-5356 CTCAGCCATCTCGTCATATTGGG + Intergenic
1186510874 X:10128878-10128900 CTCAGCCATGCCTCCATAGAAGG + Intronic
1188617474 X:32176101-32176123 GTCAGCCATGTAATGATGTAGGG - Intronic
1191586192 X:62829165-62829187 CTCCACAATGTCTTTATGTAAGG + Intergenic
1191820110 X:65296968-65296990 CTCAGCAATGACATCATATAAGG + Intergenic
1194034997 X:88860039-88860061 TTCAGCCATGTTTTCCTTTATGG - Intergenic
1195320555 X:103718430-103718452 CTGCCTCATGTCTTCATGTAGGG - Intronic
1195814673 X:108871790-108871812 ATCTACCATGTCCTCATGTAGGG - Intergenic
1196463744 X:115952851-115952873 CTGAGCTATGGCTTCCTGTACGG + Intergenic
1196464374 X:115958067-115958089 CTGAGCCATGACTTCCTGTACGG + Intergenic
1197601770 X:128539767-128539789 CTCAGCCATGTTTTGGTGTCAGG + Intergenic