ID: 1091151329

View in Genome Browser
Species Human (GRCh38)
Location 11:133331023-133331045
Sequence TGTATTGGAAAGCAGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091151329_1091151337 26 Left 1091151329 11:133331023-133331045 CCCTCTATCTGCTTTCCAATACA 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1091151337 11:133331072-133331094 GGAGTAAAACTGGAAGAGAAAGG 0: 1
1: 0
2: 0
3: 55
4: 485
1091151329_1091151333 -2 Left 1091151329 11:133331023-133331045 CCCTCTATCTGCTTTCCAATACA 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1091151333 11:133331044-133331066 CAATTGGTGTAGATAAAGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
1091151329_1091151335 16 Left 1091151329 11:133331023-133331045 CCCTCTATCTGCTTTCCAATACA 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1091151335 11:133331062-133331084 TGAGGATCCAGGAGTAAAACTGG 0: 1
1: 0
2: 0
3: 21
4: 199
1091151329_1091151334 5 Left 1091151329 11:133331023-133331045 CCCTCTATCTGCTTTCCAATACA 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1091151334 11:133331051-133331073 TGTAGATAAAGTGAGGATCCAGG 0: 1
1: 0
2: 1
3: 13
4: 165
1091151329_1091151338 27 Left 1091151329 11:133331023-133331045 CCCTCTATCTGCTTTCCAATACA 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1091151338 11:133331073-133331095 GAGTAAAACTGGAAGAGAAAGGG 0: 1
1: 0
2: 4
3: 51
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091151329 Original CRISPR TGTATTGGAAAGCAGATAGA GGG (reversed) Intronic
902672282 1:17983192-17983214 GGCAGTGGAAAGTAGATAGAGGG - Intergenic
903689253 1:25159665-25159687 TGTGTTGGAAAGCAGAGATGAGG + Intergenic
903983277 1:27205355-27205377 AGTATGGCAAAGCAGATAGTGGG + Intergenic
905764592 1:40589941-40589963 TGTCTTGGAAAGCAGGCAGCAGG - Intergenic
905821501 1:40995804-40995826 TGTATTTGAAAACAGAAAAAAGG - Intronic
907593789 1:55701210-55701232 TGCCTTGAAAAGAAGATAGATGG + Intergenic
908642732 1:66243262-66243284 GGTATAGGGAAGCAGAAAGAGGG + Intronic
908826957 1:68142302-68142324 TTTTTAGGAAAGCAGAAAGAAGG - Intronic
908930015 1:69306665-69306687 GGTGTTAGAAATCAGATAGAGGG + Intergenic
909199724 1:72675537-72675559 TATGTTGGAAAGCAGATGGGTGG + Intergenic
910814911 1:91281438-91281460 TGCATTAGGAGGCAGATAGAGGG - Intronic
911147410 1:94566278-94566300 TGTCTTTTAAATCAGATAGAAGG + Intergenic
911380646 1:97109815-97109837 TATATTGGAAAGAAAATAAAAGG + Intronic
912281091 1:108315182-108315204 TGTATTGGAATATAGATAGGAGG + Intergenic
913374695 1:118138058-118138080 TATATTGGAAAGGAGAAGGAGGG - Intronic
915381849 1:155448793-155448815 TGCATTAGAAAGAAGATAGTGGG - Intronic
916476434 1:165173815-165173837 TGGATTGGAAAACAGAAATAGGG + Intergenic
918350941 1:183654989-183655011 TGTATTGGAAAGGAGATGCTTGG + Intronic
918505342 1:185247658-185247680 TGTAGGGGAAAGCATAAAGAAGG + Intronic
918675527 1:187280326-187280348 TGTTTTGGCAAGAAGATAAATGG - Intergenic
919135448 1:193502262-193502284 AGAATTGGCAAGCAGATACAAGG + Intergenic
921312777 1:213861187-213861209 AGTTTTAGAAAGCTGATAGAGGG + Intergenic
921369407 1:214406128-214406150 TGTATTGGAAAGCTCAGATATGG - Intronic
923088181 1:230717634-230717656 TTTACTGGAAAGCAGGAAGAGGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063886481 10:10584755-10584777 TGCATTGGACAGCAGAGACAGGG - Intergenic
1065411014 10:25428636-25428658 TGTATTTGAAGACAGATTGAAGG + Intronic
1065655647 10:27946542-27946564 TGTATTTCAAAACAGCTAGAAGG - Intronic
1068054861 10:51999228-51999250 TGTATTTGGAAGCAGACACAAGG - Intronic
1068701947 10:60030038-60030060 TGTACTGGAAAGCTCTTAGAAGG + Intronic
1069548240 10:69344095-69344117 TGGATGGGAGAGCAGATTGATGG - Intronic
1069879185 10:71581125-71581147 TTTATTGGAAAGCAGGCAGAAGG + Intronic
1070039206 10:72758441-72758463 TGTATTGGTACACAGAGAGACGG + Intronic
1071713969 10:88076584-88076606 TGAAGTTGAAAGCAGAGAGAAGG - Intergenic
1074435504 10:113430927-113430949 TGTATTGGAGAGAAGAGAAAAGG + Intergenic
1079464449 11:20715357-20715379 TGTATAGGAAGGCTGACAGAAGG - Intronic
1085149194 11:74234740-74234762 TGTATAGGAGAGCAGAGAAATGG + Intronic
1085826151 11:79849766-79849788 TCCATTGGAAAGCAGAAAGAGGG + Intergenic
1086417785 11:86606378-86606400 TGTTGTGGACAGCAGAGAGATGG + Intronic
1087260321 11:96003231-96003253 TGTGTTGGAAGGCAGGGAGAAGG + Intronic
1088723125 11:112611958-112611980 TGTATTGGCAGGCAGGAAGAAGG - Intergenic
1090332237 11:125941386-125941408 GGGAATGGAAAGCAGATGGAAGG + Intergenic
1091151329 11:133331023-133331045 TGTATTGGAAAGCAGATAGAGGG - Intronic
1092403865 12:8202137-8202159 TGTATTGGCTAGCTGATGGAGGG + Intergenic
1094040478 12:26115984-26116006 TCTTTTGTAAAACAGATAGATGG + Intergenic
1094112057 12:26872385-26872407 TGTTTTGGATAGCAGTTACATGG + Intergenic
1094281656 12:28746769-28746791 TGTATGGGAGAGCAGAGAAATGG + Intergenic
1095238298 12:39825583-39825605 TGCATTTGAAAACAGATAAATGG - Intronic
1096482223 12:51950134-51950156 TGGATTGGAAACCACTTAGACGG + Intergenic
1097389450 12:58992308-58992330 TATATTGAAAAGGAGGTAGAAGG - Intergenic
1099068321 12:78012411-78012433 TGTAATGGAAACCTAATAGATGG - Intronic
1100024469 12:90111015-90111037 TGAATTGAAGAGAAGATAGAAGG + Intergenic
1100314088 12:93427559-93427581 AGAATTGGAAAGCAGATAAATGG + Intronic
1101814085 12:108131739-108131761 TTTATGAGAAAGCAGAGAGAGGG - Exonic
1105680211 13:22718285-22718307 TCTAATGCAGAGCAGATAGAGGG - Intergenic
1106551704 13:30777432-30777454 TGCCTTGGAAGGAAGATAGAAGG - Intergenic
1106714134 13:32370135-32370157 TCTATTAGAAAACAGATAAAAGG - Intronic
1107276341 13:38684629-38684651 TGTCTTGTAAATCAAATAGAAGG - Intergenic
1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG + Intronic
1108257605 13:48625782-48625804 TGTCTTGGGAAGCTGAGAGATGG - Intergenic
1109691761 13:65902871-65902893 TTACTTGGAAAGCAGTTAGAAGG - Intergenic
1109916203 13:68987947-68987969 TGTATTGTTTAGCATATAGAAGG - Intergenic
1109930971 13:69216855-69216877 TGTATGGAAAAGCAGAGGGAAGG + Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1111948051 13:94686234-94686256 TGTAATGGGAAGCAGAGAAATGG + Intergenic
1112661900 13:101519541-101519563 TTTATTGGAAAGCAGGAAGAAGG - Intronic
1113018337 13:105854122-105854144 TGTGTGGAAAATCAGATAGATGG - Intergenic
1113197376 13:107824172-107824194 TTTAGTGGAAAGCAGATGGATGG - Intronic
1113269653 13:108659598-108659620 TGTAAGGAAAAGCAGTTAGATGG + Intronic
1114582463 14:23774848-23774870 TGGATTGGAAAGCAGTGAAAAGG + Intergenic
1114867765 14:26618366-26618388 TGTATAAGGAAGCAGGTAGAAGG + Intergenic
1117974870 14:61287386-61287408 TGTACTGGAAAGAAGAGAGGGGG + Intronic
1118177330 14:63454744-63454766 AATATTGGAAAGAAGATAGGAGG - Intronic
1118299867 14:64605762-64605784 TGGGTTGGGAAGCAGATGGAGGG + Intergenic
1118965179 14:70575427-70575449 TGTATTTAAAAGCAGACACAGGG - Intergenic
1121334493 14:93069174-93069196 TGCACTGGAAAGCAGACAGCAGG - Intronic
1124670696 15:31635597-31635619 TGTTTTAGAAAGCAGACAGTGGG + Intronic
1125279749 15:38031126-38031148 TGCAAGGGAAAGCAGAAAGATGG - Intergenic
1125319274 15:38466288-38466310 TGTATTGGGATGGAGAGAGAGGG - Intronic
1126980853 15:54241124-54241146 TTTATGGGAAACCAGGTAGAGGG + Intronic
1127216102 15:56824441-56824463 TGTATTGGAAAGCCCATTGCTGG + Intronic
1127691563 15:61402286-61402308 TGCATTGGAAAGCCATTAGAAGG + Intergenic
1130826701 15:87555510-87555532 TGTATTTAAAATCAGATAGGAGG + Intergenic
1131382607 15:91976183-91976205 TGTACTGGGGAGAAGATAGATGG + Intronic
1133852775 16:9521967-9521989 TGGCTTGGAAATCAGACAGATGG - Intergenic
1134829910 16:17314522-17314544 TCTCTTGGATAGCAGATGGATGG - Intronic
1135261323 16:20983432-20983454 TGTATGGGAGACCAGTTAGAAGG - Intronic
1135584102 16:23654627-23654649 TGTATTTCAAAACAGCTAGAAGG - Intronic
1135664180 16:24322099-24322121 TGAATTGGAAACCAGACAGGCGG + Intronic
1139421975 16:66854652-66854674 AGTATTCCAAATCAGATAGAAGG + Intronic
1140243781 16:73229991-73230013 TAGATAGAAAAGCAGATAGATGG + Intergenic
1140498557 16:75411732-75411754 TGGATTGAAAAGAGGATAGATGG + Intronic
1142840526 17:2625107-2625129 TGCATTGGATAGCAGATACGTGG + Intronic
1144863006 17:18317545-18317567 TGTATTGGGAAGGAGAGCGATGG + Exonic
1146411353 17:32588512-32588534 TGTATTAAAAAGCTGTTAGAAGG + Intronic
1147463370 17:40590313-40590335 CGTAATGGTAAGCTGATAGAGGG - Intergenic
1147596124 17:41718587-41718609 TGCATGGGAAAGCAGCTATATGG + Intronic
1148645081 17:49215373-49215395 GGTATTGGAAAGCTATTAGAGGG + Intronic
1151292996 17:73164012-73164034 TGAATTGGAAATCAGATAATAGG + Intergenic
1153538776 18:6133200-6133222 TGTATTGGACAGCAAAGATATGG - Intronic
1154078700 18:11232515-11232537 TTTATTGGGTAGCAAATAGACGG - Intergenic
1156184061 18:34640863-34640885 TGCAATGAAAAGCAGCTAGAAGG - Intronic
1156476292 18:37407768-37407790 TGTCCTGGAGAGCAGACAGAAGG - Intronic
1157800963 18:50620846-50620868 TGGAAGGGAAAGTAGATAGATGG - Intronic
1158323851 18:56293324-56293346 TGTACAGGAGAGCAGAAAGATGG + Intergenic
1160184806 18:76667695-76667717 TGTCTTAGAAGCCAGATAGATGG - Intergenic
1161212446 19:3074432-3074454 TAGATGGGAAAGCAGATAGATGG - Intergenic
1164478319 19:28592146-28592168 TGTAAAGGGAAGCTGATAGAGGG - Intergenic
1165021403 19:32927180-32927202 TGTATGGGAAAGTGGATGGATGG - Intronic
1166456204 19:42942080-42942102 TTTATTGGAAAGAAGACAAAGGG + Intronic
1166901954 19:46071359-46071381 AGTACTGGAAACCAGAAAGAGGG - Intronic
925412267 2:3646755-3646777 TGCATGGGTGAGCAGATAGAGGG - Intergenic
925874564 2:8300967-8300989 TGTTTTAGGAAGGAGATAGATGG - Intergenic
926659371 2:15446101-15446123 TGTATTGGGAAGGAGAAACAAGG + Intronic
927173114 2:20387004-20387026 TGTGGTGGAAGGCAGACAGAAGG - Intergenic
928137561 2:28699648-28699670 TGTAGTGGGAAGGAGATTGATGG - Intergenic
928669840 2:33591396-33591418 TTTATTGGAAAGTTTATAGAAGG + Intronic
929094028 2:38247001-38247023 TGGAATGGAATACAGATAGAAGG + Intergenic
929101355 2:38317755-38317777 TGTAATTGAAATCAGATAGATGG - Intronic
929548020 2:42868762-42868784 TGTAAAGGAAAACAGAAAGAAGG - Intergenic
929865713 2:45715731-45715753 TGTAGTGCAAAGAAGACAGAGGG - Intronic
931586765 2:63838390-63838412 TCTATGGGAAAGTAGAAAGAAGG + Intergenic
936855387 2:116952021-116952043 GGTGTTGGAAAGCAGAGAGGCGG + Intergenic
939302892 2:140369278-140369300 TGTATTGGAGACCAGTTAGGTGG + Intronic
939933781 2:148263346-148263368 TGCATTGGGAGGCAGAGAGAGGG + Intronic
940633305 2:156265327-156265349 AGCAATGGAAAGAAGATAGAAGG - Intergenic
941765088 2:169288169-169288191 TGTATCAAAAATCAGATAGAAGG + Intronic
941942042 2:171050360-171050382 TGTAGTGGAAAGTACATACAGGG + Intronic
945800801 2:214427899-214427921 TGTATTGGAAAGGAAATGGATGG - Intronic
946368780 2:219267509-219267531 TGTATTGGATCACAGAGAGATGG + Intronic
946533652 2:220603351-220603373 TGCATTGGAAAACAGAGACACGG - Intergenic
946582071 2:221140565-221140587 TGACTTGGAAAGAAGAGAGAAGG + Intergenic
1169916312 20:10687069-10687091 TGTGTTGGAAAGCAGATGAAAGG + Intergenic
1170151342 20:13229853-13229875 AGAATTGGAAAGCTGAAAGAAGG - Intronic
1170946309 20:20894138-20894160 TGTATTAGAAAACAAATACAAGG - Intergenic
1174934036 20:54847932-54847954 AGTATTGGAAATCAGAAACATGG + Intergenic
1175499107 20:59436959-59436981 TGTTTGGGAAAGCAGGTAGAAGG - Intergenic
1176526628 21:7924181-7924203 TGTATTGGAAAGGAGAGGAATGG - Intergenic
1184120355 22:42445919-42445941 TGCAGTGGAAAGAAGACAGAGGG + Intergenic
1184506122 22:44904259-44904281 TGTTTTACAAAGCAGATAAAAGG - Intronic
1184910307 22:47527685-47527707 TTTATGGGAAAGCACACAGATGG + Intergenic
949208786 3:1473388-1473410 TACCTTGGAAAGCAGACAGAAGG + Intergenic
950699174 3:14728280-14728302 TGTATTGGACAGCAGAGGGGAGG + Intronic
950989928 3:17422606-17422628 TATATTAGAAAGGAGATAGTAGG - Intronic
951488204 3:23238158-23238180 AATATTGGAAAGCATATAGAAGG + Intronic
951598140 3:24340827-24340849 TCTATTTGATAGCAGATAAATGG + Intronic
954485179 3:50842951-50842973 AGTATTGGAAATAAGATAGTGGG - Intronic
955571846 3:60315529-60315551 TGTGTAGGAAATCACATAGAAGG + Intronic
956401878 3:68888241-68888263 TGTATTGGAAACCAGAGTAAAGG - Intronic
958058730 3:88449456-88449478 TGGATAGGAAAGAAGATACAGGG - Intergenic
958131526 3:89431946-89431968 TGTATTGGTAAGGAGAGAAATGG - Intronic
960050943 3:113238901-113238923 TGTTTTAGAAAGAAGGTAGATGG + Intronic
961161775 3:124732549-124732571 TGTATTGGAAAGCATATTTACGG - Intronic
963057681 3:141200765-141200787 TGGATTGGTGAGTAGATAGATGG + Intergenic
963500758 3:146122439-146122461 TGTAGTGGAAAGAACATAGAGGG - Intronic
968127777 3:196172570-196172592 TGTATAGGAAAACCGAAAGAGGG + Intergenic
969108456 4:4826215-4826237 TGTTTTGATAAGTAGATAGATGG - Intergenic
969141566 4:5078691-5078713 TGACTTGGGAAGCAGGTAGATGG - Intronic
969762186 4:9195628-9195650 TGTATTGGCTAGCTGATGGAGGG - Intergenic
969842881 4:9895854-9895876 TGTGCTGGAAAGCAGATCGGAGG - Intronic
971167647 4:24200597-24200619 GGGATTGGAAAGCAGACAAATGG + Intergenic
972059825 4:34855313-34855335 TGGATTTGAAAGCAGAAAGCGGG + Intergenic
975330749 4:73109447-73109469 GGTATTGGTGGGCAGATAGATGG + Intronic
976220637 4:82754378-82754400 AGAATGGGAAAGCAGAGAGAGGG + Intronic
977368505 4:96103101-96103123 TGAATTGAAAGTCAGATAGAAGG + Intergenic
977969280 4:103194273-103194295 GATTTTGGAAAGCAGAGAGAAGG - Exonic
979310338 4:119195802-119195824 TGAATTGGAATGGAGAGAGAGGG - Exonic
979993176 4:127400053-127400075 TTTACTGGAAATAAGATAGATGG - Intergenic
980028051 4:127789938-127789960 TGTATTTGAAAGAAAATCGAAGG + Intronic
980029422 4:127809607-127809629 TGTAAGTGAAAGCAGAAAGAAGG + Intronic
981701625 4:147613675-147613697 TGTGTTGGAAAGGAGAAAAAAGG + Intergenic
983338712 4:166429611-166429633 GGAATTGGAAAGCATAAAGAAGG + Intergenic
984431028 4:179649155-179649177 TGTAGTTCAAAGCAGACAGATGG - Intergenic
986522444 5:8634357-8634379 CCTATTGGAAAGCATATAGAAGG - Intergenic
986876232 5:12113868-12113890 TATACTGGAAAGCACAAAGAAGG - Intergenic
987228626 5:15869507-15869529 TATATTGGAAAGCATTAAGAGGG - Intronic
987785053 5:22488828-22488850 AGTATTGGCCAGTAGATAGAGGG - Intronic
990602129 5:57369657-57369679 TGTATTAGAAGTCATATAGAAGG + Intergenic
990831037 5:59957669-59957691 TAAATTAGAAAGCAGATAAAAGG + Intronic
991910854 5:71559280-71559302 TTTATTGGAGAGCAGATGGATGG - Intronic
993830293 5:92748435-92748457 TATATGGGAAAGTAGAAAGAAGG - Intergenic
994327015 5:98459881-98459903 TGTATAGCAGAGCAGAAAGATGG - Intergenic
995756142 5:115506444-115506466 TGTAATGGAAAGCTGAGAGATGG - Intergenic
996298201 5:121949901-121949923 TGAATTAGAAAGAAAATAGATGG - Intergenic
996373127 5:122774573-122774595 TGTATTGGACAGCACAGATAGGG + Intergenic
996847778 5:127919839-127919861 TGTAGTACAGAGCAGATAGAGGG - Intergenic
996971055 5:129368458-129368480 TTTATTGAAAAGCAAAAAGAGGG + Intergenic
999505926 5:152196281-152196303 GCTATTGGAAAGCACAAAGAAGG - Intergenic
999860220 5:155636855-155636877 AGGATTTGAAAGCAGAGAGATGG - Intergenic
999943191 5:156567204-156567226 TATATTGAAAAGCAGAAAGTAGG - Intronic
1001376366 5:171262955-171262977 TGTCATGGAAAACAGAAAGAGGG - Intronic
1003045973 6:2733036-2733058 TCTGTGTGAAAGCAGATAGAAGG - Intronic
1004440968 6:15653498-15653520 TGCACTGGAAAACAGATAAATGG + Intronic
1004639973 6:17505739-17505761 TGTGTTGAAAAGCAGATACAAGG - Intronic
1004844534 6:19625204-19625226 TGAATGGGAGAGCAGATAGGAGG + Intergenic
1005820114 6:29591366-29591388 AGTAAGAGAAAGCAGATAGAGGG - Intronic
1011096939 6:83676681-83676703 TGTAATGGGAAGCTGCTAGAGGG + Intronic
1013473267 6:110485074-110485096 TATTTTAGAAAGCAGATAGTGGG - Intergenic
1014264291 6:119257525-119257547 TGTATTGGCTACCTGATAGAAGG + Intronic
1014528331 6:122528296-122528318 TCTTTTAGAAAGCAGATAGCTGG + Intronic
1015866065 6:137728011-137728033 TGAAATGCAAAGCAGAAAGAGGG + Intergenic
1017223996 6:151998805-151998827 TGTTTTGGACAGCAAATGGAGGG - Intronic
1017748520 6:157468619-157468641 TTTATGATAAAGCAGATAGAAGG + Intronic
1021880221 7:25088110-25088132 AGGATTGGAAACCAGATAGTTGG - Intergenic
1021990898 7:26140475-26140497 CTTTTTAGAAAGCAGATAGAAGG + Intergenic
1022465158 7:30648754-30648776 TGTGTTGGAAAGAAGAGACAAGG + Intergenic
1023762742 7:43482048-43482070 TGCATTAGGAAGCAGACAGATGG - Intronic
1026965689 7:74438315-74438337 TTTATTGGAAACCAGAGAAAAGG - Intergenic
1029379794 7:100205529-100205551 TGTATTAAAAATCAAATAGAGGG + Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1030819557 7:114079342-114079364 TGGATAGCAAAGCAGATATATGG + Intergenic
1031657402 7:124374774-124374796 TGTATAAGAAAGCAGAAAAATGG + Intergenic
1031789893 7:126089030-126089052 TCTATTGGAAAAGAGAGAGAAGG + Intergenic
1032431304 7:131864345-131864367 TGTTTTGGAAAGCAAAATGAAGG - Intergenic
1032670767 7:134080531-134080553 TGGATTGGAAGGCAGATGGCAGG + Intergenic
1033355561 7:140596234-140596256 TGCATTGGAAAACAGAGAGACGG - Intronic
1033675315 7:143535425-143535447 TGTTTTGCAAAACAGATGGATGG - Intergenic
1033696522 7:143794013-143794035 TGTTTTGCAAAACAGATGGATGG + Intergenic
1033927553 7:146482351-146482373 TGTATGTGAATGCATATAGAGGG + Intronic
1035630540 8:1103853-1103875 TTTATTGGAAATCAGTTCGAGGG + Intergenic
1036168820 8:6463546-6463568 TGCAGTGGAAAGAAGATAAAAGG + Intronic
1037070231 8:14636968-14636990 TGTTTTGGAAAACAGAAAAATGG - Intronic
1037156910 8:15712627-15712649 GGGATTGGCAAGAAGATAGACGG - Intronic
1038097004 8:24324509-24324531 TTTAGTTGAAATCAGATAGAAGG + Intronic
1038167335 8:25098557-25098579 TGCATAAGAAAGCAGATAAAGGG + Intergenic
1039924861 8:41920384-41920406 TATATTGGAAAGTACATAGTGGG - Intergenic
1040867018 8:52058241-52058263 TGCATTGAAAAGCACATAGTAGG + Intergenic
1041401882 8:57454892-57454914 TGTGTTAGAAATAAGATAGAAGG + Intergenic
1042704946 8:71656236-71656258 TGGATTTGAAAGGTGATAGATGG - Intergenic
1044337552 8:91005065-91005087 TGCTTTGAAAAGCAGATAGATGG + Intronic
1044559591 8:93599732-93599754 TGTATTCAAAAGCAAATAGATGG - Intergenic
1044861093 8:96524733-96524755 TGTATTGGAAAGGAGAAAAAAGG - Intronic
1046325444 8:112638265-112638287 TGTCTAGGAAAACACATAGAAGG - Intronic
1047985846 8:130232874-130232896 TGCATTGGGAAACAGATAGCAGG + Intronic
1048744885 8:137603239-137603261 AGCATTTGAAAGGAGATAGAAGG + Intergenic
1051152004 9:14091543-14091565 TTTATTGGAATGCAGATAGTTGG - Intronic
1051618861 9:19032198-19032220 TGCCCTGGGAAGCAGATAGAAGG + Intronic
1051834711 9:21322531-21322553 TGGATTTGAAAGCAGATTAAAGG - Intergenic
1052609066 9:30745702-30745724 TGTATTGAAAACAAGCTAGATGG + Intergenic
1056302772 9:85258850-85258872 TGCATTGGAAATTATATAGAGGG - Intergenic
1057085890 9:92209666-92209688 GGAATTGGAAAGCAGATAGACGG - Intergenic
1058778127 9:108305571-108305593 TAAATTAGAAAGCACATAGAAGG - Intergenic
1060127654 9:121065384-121065406 TATCTTGGAAAGCAGTTAGGTGG + Intergenic
1062051943 9:134451978-134452000 TGGATTGGTAAGCGGATGGATGG - Intergenic
1062650030 9:137570865-137570887 TGCTTTGGAAAGAAGGTAGAAGG - Intronic
1188866703 X:35321730-35321752 TGTATTGGAAGAAAGATAGGAGG - Intergenic
1189281809 X:39824395-39824417 TCTATTGGACAGCACAGAGATGG - Intergenic
1191841299 X:65515180-65515202 TGTATATGTAAGCACATAGAGGG - Intronic
1191942261 X:66493640-66493662 TGAATTGGAATGGAGAGAGAGGG - Intergenic
1193918007 X:87390400-87390422 TGTATATGAAAGCAGAAAAATGG + Intergenic
1195284429 X:103369955-103369977 CATAGTGGAAAGCAGAAAGAGGG - Intergenic
1195702870 X:107717763-107717785 TGTATGGGAGAGCAGCTAGGTGG + Intronic
1198425727 X:136518182-136518204 TGTAATGGAAAGCCAACAGAGGG + Intergenic
1199570416 X:149261935-149261957 TTTATCAGAAAGCAAATAGAGGG - Intergenic
1201668907 Y:16492993-16493015 CTTATTGGAAAGCAGCTAGTAGG - Intergenic