ID: 1091154599

View in Genome Browser
Species Human (GRCh38)
Location 11:133361525-133361547
Sequence CTGTCTGCGCGCCGGGACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091154599_1091154615 25 Left 1091154599 11:133361525-133361547 CCCGTGTCCCGGCGCGCAGACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1091154615 11:133361573-133361595 GGGCACCTGCAGCTATTCCGGGG 0: 2
1: 3
2: 1
3: 17
4: 143
1091154599_1091154614 24 Left 1091154599 11:133361525-133361547 CCCGTGTCCCGGCGCGCAGACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1091154614 11:133361572-133361594 GGGGCACCTGCAGCTATTCCGGG 0: 2
1: 3
2: 1
3: 29
4: 250
1091154599_1091154613 23 Left 1091154599 11:133361525-133361547 CCCGTGTCCCGGCGCGCAGACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1091154613 11:133361571-133361593 CGGGGCACCTGCAGCTATTCCGG 0: 2
1: 3
2: 2
3: 6
4: 103
1091154599_1091154610 5 Left 1091154599 11:133361525-133361547 CCCGTGTCCCGGCGCGCAGACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1091154610 11:133361553-133361575 GGGCACCTGCAGCTACTCCGGGG 0: 2
1: 3
2: 2
3: 17
4: 230
1091154599_1091154608 3 Left 1091154599 11:133361525-133361547 CCCGTGTCCCGGCGCGCAGACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1091154608 11:133361551-133361573 CGGGGCACCTGCAGCTACTCCGG 0: 2
1: 3
2: 1
3: 21
4: 159
1091154599_1091154609 4 Left 1091154599 11:133361525-133361547 CCCGTGTCCCGGCGCGCAGACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1091154609 11:133361552-133361574 GGGGCACCTGCAGCTACTCCGGG 0: 2
1: 3
2: 1
3: 24
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091154599 Original CRISPR CTGTCTGCGCGCCGGGACAC GGG (reversed) Intronic
901798084 1:11691902-11691924 CTGGCTGCGAGCCCGGACAAAGG + Intronic
902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG + Intergenic
902812426 1:18896185-18896207 CTGTGTGCCCGCCAGGCCACAGG + Intronic
905000311 1:34662976-34662998 CTGTCTTCAAGCTGGGACACTGG + Intergenic
910433092 1:87178022-87178044 CTGTCCTCCCGCCAGGACACTGG - Intergenic
1067045034 10:42980712-42980734 CTGTCTGCACCCAGGGCCACAGG + Intergenic
1067465804 10:46497901-46497923 CTGTGTGGGCCCCTGGACACTGG + Intergenic
1067621383 10:47886705-47886727 CTGTGTGGGCCCCTGGACACTGG - Intergenic
1068783350 10:60944396-60944418 GTGTCTGTGCTCTGGGACACGGG + Intronic
1073217221 10:101843349-101843371 CGGTCTGGGCGGCAGGACACTGG - Intronic
1075728684 10:124623556-124623578 CTGCCTGAGCGCAGGGACAGAGG - Exonic
1083112152 11:60421644-60421666 CTGTCTTTGAGCTGGGACACTGG - Intergenic
1091154599 11:133361525-133361547 CTGTCTGCGCGCCGGGACACGGG - Intronic
1091451096 12:572300-572322 CTGACTGTGCGCTGGCACACAGG - Intronic
1097276720 12:57818654-57818676 CTGCTTACGCGCCGGGAAACTGG - Intronic
1104714232 12:131005923-131005945 CTGTCAGCGCTCCAGGCCACAGG - Intronic
1104899389 12:132180394-132180416 CTGTCTACGAGCCAGGAAACAGG + Intergenic
1106241817 13:27919165-27919187 CTCTCTACGGGCCGGGACCCTGG - Intergenic
1106517217 13:30465587-30465609 CTGCCTGAGGGCCGGGGCACCGG + Intronic
1106720112 13:32427871-32427893 CGGTCTGGGCGCCGGTGCACGGG - Intronic
1108013839 13:46052483-46052505 CTGTCCCCGCGCCTGGACCCAGG + Intronic
1113491278 13:110693948-110693970 CTTTTTGTGTGCCGGGACACTGG - Intronic
1119178032 14:72583881-72583903 CTGTCTGCTCATGGGGACACAGG + Intergenic
1120032060 14:79653059-79653081 CTGTCTGCACGTGGGGACTCTGG - Intronic
1122265373 14:100544329-100544351 CTGCCTGGGTGCCTGGACACCGG - Intronic
1127057983 15:55152013-55152035 CTGTCTACCAGCCTGGACACAGG - Intergenic
1127328630 15:57918173-57918195 CTGTCTGGGCTCTGGGACACTGG - Intergenic
1129221513 15:74134267-74134289 CTGGCTGCGCGCTGGGGCCCTGG + Exonic
1133062547 16:3184010-3184032 CCGTCTGCGTCCCGGGACCCCGG + Intergenic
1133063113 16:3188266-3188288 CCGTCTGCGTCCCGGGACCCCGG - Intergenic
1140661651 16:77195070-77195092 CTGTCGGGGCGCCGGGCCTCCGG + Exonic
1141694605 16:85613607-85613629 CTGGCTGCGGGCGGGGACTCGGG + Intronic
1142131114 16:88431884-88431906 CTGTCTGCGAACAGGGACTCCGG + Exonic
1142638287 17:1270978-1271000 CCGGCCGCGCGCGGGGACACCGG + Exonic
1144812352 17:18008612-18008634 CTGTCTGGGCCCCAGGACAGAGG - Intronic
1146672593 17:34751948-34751970 CTGTCTGTGAACCGGGAAACAGG - Intergenic
1147636343 17:41966806-41966828 CCGCCTGCGCGGAGGGACACGGG - Exonic
1152592357 17:81219953-81219975 CTGCCAGGACGCCGGGACACAGG + Exonic
1154078572 18:11230646-11230668 CTGTCTTCAAGCTGGGACACTGG + Intergenic
1154176776 18:12091400-12091422 CTGCCTGCGCGCAGGGGCAGGGG - Intergenic
1155159178 18:23182006-23182028 CTGGCTGCACGCTGGGCCACTGG - Intronic
1157966800 18:52217645-52217667 ATGTCTGAGCCCTGGGACACTGG - Intergenic
1164558613 19:29272649-29272671 CTGTCTGCAAGCTGGGACATCGG - Intergenic
925099080 2:1230347-1230369 ATGTCTGGGGGCCGGGACTCAGG + Intronic
926240290 2:11080248-11080270 CTGCCTGCGAGCAGGGACACAGG - Intergenic
927212086 2:20645279-20645301 GTGTCTGCCCGCCCGGACCCCGG + Intronic
929597283 2:43184213-43184235 CTGCCTGGGCGCCGGGGAACTGG - Intergenic
932397537 2:71458447-71458469 CTGTCTGCCCCCAGGGACACTGG + Intronic
934554813 2:95281637-95281659 CTGTCTGGGAGCTGGGACCCTGG + Intronic
945290705 2:208124435-208124457 CAGCCTGCGCCCCGGGACCCCGG - Intronic
1171220050 20:23388034-23388056 CTGTCTTAGAGCCAGGACACTGG + Intronic
1182073536 22:27479397-27479419 CTGTCTGCCCCCCAGGAGACAGG + Intergenic
1184373783 22:44099031-44099053 CTGTCTGGGCTCTGGGACCCTGG + Intronic
1185255048 22:49827332-49827354 TTGTCTGCGGGCCGGGAGCCCGG - Intronic
1185292652 22:50034932-50034954 CTGGCAGCTGGCCGGGACACAGG - Intronic
949887238 3:8705803-8705825 CTGTCTGAGCTCCAGGCCACAGG - Intronic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
968943359 4:3650976-3650998 CTGTCTGCACGCAGGGATGCCGG - Intergenic
971349824 4:25845838-25845860 CTGGCTGGGGGTCGGGACACGGG + Intronic
980053816 4:128061612-128061634 CCGTCTCTCCGCCGGGACACCGG - Intronic
982198154 4:152936372-152936394 CGGTCTGCGCGCCGGGAGCGGGG + Exonic
985652149 5:1112196-1112218 CTGTCTGACCGCCGCGACCCGGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
1002313286 5:178327703-178327725 CTGTCTGCACCCCTGGACAGAGG - Intronic
1006450679 6:34104129-34104151 CTGTCTGTGGGCCAGGACACAGG + Intronic
1007252085 6:40502665-40502687 CTGTCTGGGCTCTGGGAGACAGG - Intronic
1007654866 6:43445908-43445930 CTCTCTGTGCTCCGGGCCACAGG + Exonic
1016428476 6:143958521-143958543 CTGTCTGCCTCTCGGGACACAGG + Intronic
1016438881 6:144064088-144064110 CTGCCTCCGCGCGGGGACAGTGG + Intronic
1023828458 7:44025229-44025251 ATGTCTGAGCCCTGGGACACTGG + Intergenic
1024598553 7:50960600-50960622 CTGTCTGCTGGAGGGGACACAGG + Intergenic
1024967588 7:55037981-55038003 CTAACTGGGCGCCGGAACACCGG - Intronic
1026931361 7:74224617-74224639 CTGTCTGCCCGCTGGTCCACAGG + Exonic
1029756759 7:102578656-102578678 ATGTCTGAGCCCTGGGACACTGG + Intronic
1032408100 7:131672318-131672340 CTGTCCTCACGCGGGGACACAGG - Intergenic
1037967374 8:23145170-23145192 CTGGCTGGGGGCTGGGACACTGG + Intronic
1048768935 8:137874325-137874347 CTGTCTTTGAGCTGGGACACTGG + Intergenic
1049098149 8:140560870-140560892 CTATCTGCGCTTGGGGACACAGG - Intronic
1195233806 X:102877511-102877533 CTGTCTGCTGTTCGGGACACTGG + Intergenic
1198177642 X:134172261-134172283 CGAGCTGCGCGCTGGGACACTGG - Intergenic