ID: 1091154661

View in Genome Browser
Species Human (GRCh38)
Location 11:133361742-133361764
Sequence CCGCAGCCGCTCCCAAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 270}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091154653_1091154661 -5 Left 1091154653 11:133361724-133361746 CCGCTCACCCCTGCAGGCCCGCA 0: 1
1: 0
2: 4
3: 39
4: 427
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154646_1091154661 25 Left 1091154646 11:133361694-133361716 CCATAAGCGCCTAGAGAGCCACG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154649_1091154661 2 Left 1091154649 11:133361717-133361739 CCGCGCCCCGCTCACCCCTGCAG 0: 1
1: 0
2: 14
3: 69
4: 575
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154645_1091154661 26 Left 1091154645 11:133361693-133361715 CCCATAAGCGCCTAGAGAGCCAC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154643_1091154661 28 Left 1091154643 11:133361691-133361713 CCCCCATAAGCGCCTAGAGAGCC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154644_1091154661 27 Left 1091154644 11:133361692-133361714 CCCCATAAGCGCCTAGAGAGCCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154647_1091154661 16 Left 1091154647 11:133361703-133361725 CCTAGAGAGCCACGCCGCGCCCC 0: 1
1: 0
2: 2
3: 8
4: 114
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154648_1091154661 7 Left 1091154648 11:133361712-133361734 CCACGCCGCGCCCCGCTCACCCC 0: 1
1: 0
2: 11
3: 173
4: 1211
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154652_1091154661 -4 Left 1091154652 11:133361723-133361745 CCCGCTCACCCCTGCAGGCCCGC 0: 1
1: 0
2: 2
3: 43
4: 372
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270
1091154651_1091154661 -3 Left 1091154651 11:133361722-133361744 CCCCGCTCACCCCTGCAGGCCCG 0: 1
1: 0
2: 2
3: 38
4: 339
Right 1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091154661 Original CRISPR CCGCAGCCGCTCCCAAGGGC TGG Intronic
900287053 1:1906855-1906877 CTTCAGCCACTCCCAAGGGCTGG - Intergenic
901536364 1:9884907-9884929 CCGCAGCCCCACCCCAGTGCTGG - Intronic
902540750 1:17152773-17152795 CTGCATCTGCTCTCAAGGGCTGG - Intergenic
902942303 1:19809197-19809219 CCTCAGCCCCTCCAAAGGCCAGG - Intergenic
903263361 1:22142940-22142962 CCGCAGCCGCTGCCCCGGGCCGG - Exonic
904468886 1:30723689-30723711 CCCCAGCCCCCCCAAAGGGCGGG + Intergenic
905020543 1:34808049-34808071 ACACAGCAGCTCTCAAGGGCTGG + Intronic
905865161 1:41372491-41372513 CTGCAGCTGCTCCCAGGGCCTGG + Intronic
906023815 1:42655986-42656008 CCTCAGCCTCTCCCAAGTACAGG + Intergenic
906353684 1:45084807-45084829 CCACAGCTGCTTTCAAGGGCTGG + Intronic
907467304 1:54647358-54647380 CCTCAGCCTCTCCAAAGTGCTGG - Intronic
909436862 1:75652152-75652174 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
909543064 1:76812641-76812663 CCGCAGCCCCTCCCATGGACTGG + Intergenic
911747177 1:101452845-101452867 ACGCGGCCCCTCCCAAGTGCTGG + Intergenic
911805392 1:102200613-102200635 CCGCAGCTGCTTTCATGGGCTGG + Intergenic
912735146 1:112143776-112143798 CACCAGCCCCTGCCAAGGGCAGG - Intergenic
912797121 1:112700017-112700039 CCACAGCCCCTGCCTAGGGCAGG + Intronic
913202585 1:116507370-116507392 CCTCAGCCTCTCCAAAGTGCTGG - Intergenic
915637064 1:157194870-157194892 CCGCAGCAGCTCCCAGGGGCGGG - Intergenic
916013879 1:160731065-160731087 CCTCAGCCTCTCCAAAGTGCTGG + Intergenic
917578033 1:176344766-176344788 CCACAGCTGCTCTCAAGAGCTGG + Intergenic
917795170 1:178528123-178528145 CCTCAGCCCCTGCCAAGTGCAGG - Intronic
920651136 1:207838317-207838339 CAGCTGTGGCTCCCAAGGGCAGG + Intergenic
922630055 1:227097795-227097817 ATGCAGCCCCTCCCAAGTGCTGG + Intronic
922774083 1:228207080-228207102 CAGCATCCCCTCCCCAGGGCTGG + Intronic
1062765199 10:57193-57215 CCACAGCTGCTCTCATGGGCTGG + Intergenic
1063295765 10:4804167-4804189 CCCCAGGGGCTCCAAAGGGCTGG + Intronic
1063452938 10:6163652-6163674 CCGCAGCTGCTCCCGGGGCCCGG - Intronic
1063453039 10:6164026-6164048 CCGCAGCCACACCCAACGCCGGG - Intronic
1065265509 10:23971151-23971173 ACGCGGCCCCTCCCAAGGGCGGG - Intronic
1065521827 10:26580566-26580588 CAGGAGCAGCTCCCAAGGCCAGG - Intergenic
1065528320 10:26644181-26644203 CAGGAGCAGCTCCCAAGGCCAGG - Intergenic
1065558916 10:26943361-26943383 CAGGAGCAGCTCCCAAGGCCAGG + Intergenic
1068497058 10:57796130-57796152 GTGCAGCCCCTCCCAAGGGCTGG + Intergenic
1069819529 10:71218716-71218738 CCACAGCCGCTCCCATGCTCTGG - Intronic
1069837659 10:71319386-71319408 CCGCAGCCGCCCCCAGGGCCCGG - Intronic
1071828985 10:89353397-89353419 CCCCAGCCCCTCCCAAGTGCTGG + Intronic
1077394113 11:2312749-2312771 CAGCAGCTGCCCCAAAGGGCTGG - Intronic
1080909464 11:36581222-36581244 CCACAGCTGCTCTCAAGGGTTGG + Intronic
1081666777 11:44921228-44921250 CTGCAGCTGCTCCCCACGGCAGG - Intronic
1081831919 11:46121565-46121587 CCCCCGCCGCTCCCGAGAGCCGG + Intergenic
1083890077 11:65591672-65591694 CCCCAGCAGTTCCCGAGGGCAGG - Intronic
1086349594 11:85932321-85932343 ATGCAGCCCCTCCCAAGGGCTGG - Intergenic
1088188902 11:107205359-107205381 CCACAGCTGCTCTCAAGGGCTGG + Intergenic
1090980261 11:131713973-131713995 ACGCAGCCCCTCCCAGGAGCTGG - Intronic
1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG + Intronic
1091395748 12:153375-153397 CTGCAGACGCTCCCAACGGCAGG - Intronic
1094257758 12:28454506-28454528 CTGCAGCCTCTCCCTAGGGAGGG - Intronic
1094324390 12:29220994-29221016 CAGTAGCCCCTCCCAAGCGCTGG - Intronic
1095211579 12:39500855-39500877 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1097098783 12:56571384-56571406 CAGCAGCCGGTCCCAGAGGCTGG - Intronic
1100102927 12:91131337-91131359 CCGCAATCGCTCCCCTGGGCTGG - Intergenic
1101482033 12:105107679-105107701 CCGCCTCCGCTCGCGAGGGCCGG - Intronic
1101595583 12:106161787-106161809 CTGCAGCGGTTGCCAAGGGCTGG - Intergenic
1103093664 12:118115948-118115970 ATGCAGCCCCTCCCAAGTGCTGG - Intronic
1103716843 12:122950016-122950038 CCGCAGCCCCACTCCAGGGCTGG + Intronic
1103885202 12:124195282-124195304 GCCCAGCCGCTCCTAAGGGCTGG - Intronic
1103951149 12:124551863-124551885 CCGCGGCCTTTCCCAAGGGGCGG - Intronic
1103956919 12:124582479-124582501 CCACAGCAGCTCCCCAGGGCAGG - Intergenic
1104811199 12:131621290-131621312 CCTCAGCCTCTCCCCGGGGCAGG + Intergenic
1104982576 12:132580856-132580878 CAGCAGCCCCTCCCAGGGCCCGG + Intronic
1105491186 13:20890197-20890219 CCTCAGCCTCTCCAAAGTGCTGG - Intronic
1107236692 13:38178932-38178954 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1108013831 13:46052450-46052472 CCGCCGCCGCTCCGAGGAGCGGG + Intronic
1110033891 13:70654449-70654471 CTGAAGCTGCTCTCAAGGGCTGG - Intergenic
1110930681 13:81212233-81212255 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
1111539113 13:89648625-89648647 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
1113306878 13:109088865-109088887 CCGCAACCGCTCAGGAGGGCGGG + Intronic
1115134292 14:30090614-30090636 CCACAGCTGCTCTCAAGGGCTGG + Intronic
1115335489 14:32240866-32240888 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1115852983 14:37602103-37602125 CCCCAGGCGCCCCCAAGAGCAGG - Intronic
1116173283 14:41430359-41430381 ATGCAGCCACTCCCAAGTGCTGG + Intergenic
1116742712 14:48776837-48776859 CCGCAGCTGCTTTCATGGGCTGG - Intergenic
1117253664 14:53957051-53957073 CCCCAGCCGCTTCCCAGAGCTGG - Intronic
1121721548 14:96112337-96112359 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1121722306 14:96118068-96118090 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1122722488 14:103730152-103730174 TGGCAGAGGCTCCCAAGGGCAGG - Intronic
1122785755 14:104162658-104162680 CTGCAGCCCCTCCCAAGGCTGGG - Intronic
1123111095 14:105867161-105867183 CCCCAGCCTCTCCCAACAGCTGG + Intergenic
1123126220 14:105947915-105947937 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1123777867 15:23598399-23598421 GCTCAGCTGCTGCCAAGGGCTGG - Intronic
1123825122 15:24073481-24073503 ACGCAGCCCCTCCCATGTGCTGG - Intergenic
1123856348 15:24415956-24415978 CCACGGCTGCTCTCAAGGGCTGG + Intergenic
1124301303 15:28546014-28546036 CCGCAGTCGCACCCAAGCCCGGG - Intergenic
1124821599 15:33051747-33051769 ATGCAGCCCCTCCCAAGTGCTGG + Intronic
1125251836 15:37713720-37713742 CTGCAGCTTCTCTCAAGGGCTGG - Intergenic
1125434724 15:39632426-39632448 CCTCAGCCTCTCCAAAGTGCTGG + Intronic
1126815306 15:52448120-52448142 CCACAGCTGCTCTCAGGGGCTGG - Intronic
1127012864 15:54649382-54649404 CCGCAGCTGCTTTCAGGGGCTGG + Intergenic
1128454946 15:67827095-67827117 CCGCCGCCGCTCCCAGTGCCAGG - Intronic
1128732575 15:70031106-70031128 CAGCAGCAGCTCCGGAGGGCAGG + Intergenic
1129055839 15:72819723-72819745 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
1129108643 15:73324904-73324926 GGGCAGCTGCTCCCAGGGGCTGG - Intronic
1131723440 15:95196699-95196721 CCGCAGGCGCTCACCAGGGAAGG + Intergenic
1132261074 15:100425327-100425349 CAGCGGCTGCTCTCAAGGGCTGG - Intronic
1132605153 16:790552-790574 CCTCAGGGGCCCCCAAGGGCTGG - Exonic
1133043038 16:3070709-3070731 CCGCAGCTGCTTTCATGGGCTGG + Intronic
1133045123 16:3083644-3083666 CCGCAGCTGCTTTCATGGGCTGG + Intergenic
1134606802 16:15577739-15577761 TTGCAGCCTCTCCCAAGCGCTGG - Intronic
1136115829 16:28093675-28093697 CCTCAGCTTTTCCCAAGGGCTGG + Intergenic
1138679095 16:58672208-58672230 CCACAGCAGCTCCAAAGGTCAGG + Exonic
1140477359 16:75245539-75245561 CCCCAGCCGCTCACCTGGGCCGG - Intronic
1142172871 16:88632045-88632067 CCCCAGCGGCTCCCGAGTGCTGG - Intergenic
1142439458 16:90086122-90086144 CCACAGCTGCTCTCATGGGCTGG - Intronic
1203141676 16_KI270728v1_random:1771327-1771349 CCACAGCCTCCCCCCAGGGCTGG - Intergenic
1203141693 16_KI270728v1_random:1771374-1771396 CCACAGCCTCCCCCCAGGGCTGG - Intergenic
1143401919 17:6651725-6651747 CCTCAGGCGCTCCCACGGCCCGG - Exonic
1144648582 17:16991621-16991643 CAGCAGCCGCTCCCAGGCTCAGG + Intergenic
1147250866 17:39151775-39151797 CTGCAGCCGCTCCCAAGGCAAGG + Intronic
1148664242 17:49362357-49362379 GCGCCGCCGCTCCCAGCGGCCGG - Intronic
1150816307 17:68394953-68394975 CCACAGCCTCTCCTATGGGCTGG - Intronic
1150823800 17:68457386-68457408 CCGCGGACGCTCCCCCGGGCGGG - Exonic
1152643698 17:81459405-81459427 CCGCAGCCACTCCCAGGCCCAGG + Intronic
1152958113 18:57534-57556 CCACAGCTGCTCTCATGGGCTGG + Intronic
1153348886 18:4057418-4057440 GTGCAGCCCCTCCCAAGTGCTGG + Intronic
1153539244 18:6136244-6136266 TCACAGCCCCTCCCAAGTGCTGG + Intronic
1153746040 18:8180609-8180631 ATGCAGCCCCTCCCAAGTGCCGG - Intronic
1153788142 18:8553219-8553241 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1154040734 18:10853176-10853198 ATGCAGCCCCTCCCAAGGGCTGG + Intronic
1154428719 18:14291947-14291969 CTGCAGCTGCTCTCACGGGCTGG + Intergenic
1155166428 18:23235999-23236021 CCGCAGCCTCTCCATAGGCCGGG + Exonic
1155745772 18:29355428-29355450 CGGTAGCCCCTCCCAAGGCCTGG + Intergenic
1157274777 18:46302796-46302818 CCGTAGCCCCTCCCATCGGCTGG - Intergenic
1158094613 18:53756514-53756536 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
1159095516 18:63897326-63897348 CCACACCAGCTCCCTAGGGCTGG + Intronic
1160033144 18:75279500-75279522 CTGCAGCCCCTCCCATGGGAAGG + Intronic
1160600606 18:80009811-80009833 ACGCAGCCCCTCCCAAGCTCTGG - Intronic
1161041126 19:2111257-2111279 TGGCAGCCGCTCCCAGGGGCAGG - Intronic
1162741932 19:12778406-12778428 CTCCACCCGCTCCCAGGGGCTGG - Intronic
1163292584 19:16389202-16389224 CCTCAGCCCCTCCAAAGTGCTGG - Intronic
1165454708 19:35903887-35903909 CCGCAGCCCCGCCCAAGGTGAGG + Exonic
1166795061 19:45420871-45420893 CCTCAGCCTCTCCAAAGTGCTGG + Intronic
1167508954 19:49885857-49885879 CCTCAGCCGATCCCAACAGCTGG - Intronic
925035998 2:686313-686335 CCACAGCTGCTCTCAAGGACTGG - Intergenic
925806350 2:7653689-7653711 ATGCAGCCCCTCCCAAGGGCTGG + Intergenic
926637311 2:15195888-15195910 ACACAGCCCCTTCCAAGGGCTGG + Intronic
927053416 2:19350592-19350614 CCGCGGCCTTTCCCAAGCGCAGG - Intergenic
927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG + Intronic
928432803 2:31234502-31234524 CCGCCGCCTCACCCAAGCGCGGG - Exonic
930762216 2:55049764-55049786 CCCCGGCCGCGCCCAAGCGCAGG - Exonic
932005549 2:67923748-67923770 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
933707002 2:85298817-85298839 CCTCAGCTGCCCCCAGGGGCAGG - Intronic
934686442 2:96325315-96325337 CCGCAGCCGCTCCCGCCGTCCGG - Intronic
935798776 2:106671508-106671530 CTGCAGCTGCTCTCAAGGGCTGG - Intergenic
936433308 2:112482415-112482437 CCGCAGCCTCTTCCAGTGGCCGG - Exonic
939577127 2:143909312-143909334 ACGCAGCCCCTCCCAAGTGCTGG + Intergenic
940149007 2:150578525-150578547 CCACAGGTGCTCTCAAGGGCTGG + Intergenic
940782942 2:157952662-157952684 ATGCAGCCCCTCCCAAGTGCTGG + Intronic
941998390 2:171623008-171623030 AAGCAGCCCCTCCCAAGTGCTGG - Intergenic
942299606 2:174548820-174548842 CCGCAGCCGCTCCGAGTGCCGGG + Intergenic
942669862 2:178363627-178363649 CAGCAGCCGCTCACAAGGAAGGG + Intronic
944476627 2:200113087-200113109 CTGCAGCCCCTTCCAAGTGCTGG + Intergenic
946780315 2:223187983-223188005 ATGCAGCCCCTCCCAAGTGCTGG - Intronic
946898080 2:224345225-224345247 TCGCAGCTGCTCTCATGGGCTGG + Intergenic
947994118 2:234512616-234512638 CTGCTGCCACTCCCTAGGGCTGG - Intergenic
948149804 2:235736198-235736220 CCACAGCACCTCCCAACGGCGGG - Intronic
1171818679 20:29812526-29812548 CCACAGCTGCTCTCATGGGCTGG + Intergenic
1171899122 20:30840499-30840521 CCACAGCTGCTCTCATGGGCTGG - Intergenic
1172701135 20:36854403-36854425 CAGCAGCAGCTCCCCAGGTCAGG - Intronic
1173868570 20:46328377-46328399 CCGCAGCCCCAGCCCAGGGCGGG - Intergenic
1174000671 20:47372246-47372268 CCGGAGCAGCTGCTAAGGGCTGG - Intergenic
1175113666 20:56666513-56666535 CAGCAGCCCCACACAAGGGCTGG + Intergenic
1175299151 20:57930508-57930530 CTGCAGCCTGCCCCAAGGGCTGG + Intergenic
1175412001 20:58776579-58776601 CCGGAGCCCCTGCCAAGTGCTGG - Intergenic
1175689077 20:61052773-61052795 CCCCAGCCCCACCCAAAGGCAGG - Intergenic
1176690584 21:9903710-9903732 CTACAGCTGCTCTCAAGGGCTGG + Intergenic
1179009989 21:37549050-37549072 ACGCGGCCCCTCCCAAGTGCTGG - Intergenic
1179235062 21:39538516-39538538 ACGCAGCCCCTCCCAAGTGCTGG - Intergenic
1179254855 21:39706762-39706784 ATACAGCCCCTCCCAAGGGCTGG - Intergenic
1179426545 21:41284036-41284058 ACGGAGCTGCTCCCAAGGACAGG + Intergenic
1179606397 21:42518341-42518363 CCCCTGCCGCTCCCACAGGCTGG - Exonic
1180134433 21:45853059-45853081 CCGCATCTGCTCCCAATGCCTGG - Intronic
1180140333 21:45889586-45889608 CAGCATCCTTTCCCAAGGGCGGG - Intronic
1180153483 21:45965284-45965306 CCACAGCTGCTCTCAAGGGCTGG - Intergenic
1180322124 22:11331900-11331922 CCACAGCTGCTCTCATGGGCTGG + Intergenic
1180332789 22:11547802-11547824 CCACAGCTGCTCTCATGGGCTGG - Intergenic
1180585165 22:16881890-16881912 CCTCAGCCTCTCCCAGTGGCTGG - Intergenic
1181280267 22:21714676-21714698 CAGCAGCACCTCCCAAGTGCCGG + Intronic
1182739882 22:32560054-32560076 CTGCAGCCCCTCCCAAGTGCTGG + Intronic
1183830918 22:40418011-40418033 CCACAGCCTCTCCCCGGGGCAGG + Intronic
1184127707 22:42500147-42500169 CCCCATCCGCTCCCACTGGCTGG - Intergenic
1184418741 22:44367049-44367071 CCGAAGCCGGTCACATGGGCAGG - Intergenic
1184438838 22:44496807-44496829 CTGCAGACGCTACCAAGTGCTGG + Exonic
1185097822 22:48821315-48821337 CTTCAGCCGCTCCAAAAGGCTGG + Intronic
1185292156 22:50032538-50032560 CCGCAGCCGCTCGCCTGGGCCGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953798903 3:46006403-46006425 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
953898446 3:46823032-46823054 CCGCAGCTGCTTTCATGGGCTGG + Intergenic
956489240 3:69753562-69753584 CTGCAGCTGCTCTCAAGGGCTGG - Intronic
956669306 3:71671414-71671436 CCGGAGCCGCTCGCAGGGGGAGG + Intergenic
957087818 3:75698922-75698944 CCACAGCTGCTCTCATGGGCTGG - Intergenic
959214760 3:103437396-103437418 CCACAGCTGCTCTCAAGGGCTGG + Intergenic
959401276 3:105905021-105905043 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
961169328 3:124785172-124785194 CCGTAGCCTCCCACAAGGGCAGG + Intronic
961539055 3:127588242-127588264 CAGATGCTGCTCCCAAGGGCAGG + Intronic
961684203 3:128618118-128618140 CCGCAGGGGCTCCCAAGGCCGGG + Intergenic
962277487 3:134027287-134027309 CCGGAGCCGCACCCTAGCGCTGG + Intronic
963214004 3:142724468-142724490 CCCCAGCCACGCCCCAGGGCTGG - Exonic
964282345 3:155080098-155080120 CGGCAGCCGCTCCCCTCGGCTGG - Intronic
964763282 3:160154527-160154549 CTGCTGCCGCTCCCTTGGGCTGG + Intergenic
967592970 3:191299815-191299837 CCGTGGCTGCTCTCAAGGGCTGG - Intronic
967827121 3:193885959-193885981 ACGCGGCCCCTCCCAAGTGCTGG + Intergenic
967954797 3:194869819-194869841 CCACAGCAGCTCCCAAGGCAGGG - Intergenic
968123607 3:196143039-196143061 CCTCCGCAGCTCCCCAGGGCGGG + Intergenic
969198473 4:5582251-5582273 CAACAGCTGCTCTCAAGGGCTGG - Intronic
969335724 4:6508801-6508823 ACGCAGCCCCTCCCAAGTGCTGG + Intronic
969929310 4:10614566-10614588 CAGCAGCATCTCCCAAGGGCTGG + Intronic
969947443 4:10798975-10798997 ATGCAGCCCCTCTCAAGGGCTGG - Intergenic
971322745 4:25618471-25618493 CCGCAGCCCCTCCCCAGGCCTGG - Intergenic
971545423 4:27879763-27879785 CCACAGCTGCTCTCATGGGCTGG + Intergenic
971684893 4:29751699-29751721 CCTCAGCCTCCCCAAAGGGCTGG - Intergenic
972411796 4:38802484-38802506 GTGCAGCCCATCCCAAGGGCTGG + Intronic
972671093 4:41214607-41214629 GCGCAGCCGCTGCCAAAGCCTGG - Intronic
972986456 4:44771987-44772009 ATGCAGCCACTCCCAAGAGCTGG + Intergenic
973118845 4:46492610-46492632 ATGCAGCCCCTCCCAAGAGCTGG - Intergenic
973368204 4:49224820-49224842 CTGCAGCTGCTCTCATGGGCTGG - Intergenic
973392843 4:49570605-49570627 CTGCAGCTGCTCTCATGGGCTGG + Intergenic
975221825 4:71821409-71821431 CTGCAGCCCCTCCCAACTGCTGG - Intergenic
980353983 4:131721633-131721655 CTACAGCTGCTCTCAAGGGCTGG + Intergenic
980944807 4:139308864-139308886 CCTCAGCCTCTCCCAAGTGCTGG + Intronic
982126723 4:152190051-152190073 CTGCAGCCAGTCCCCAGGGCTGG - Intergenic
982564525 4:156971459-156971481 CCGCGGCGGGTCCCACGGGCCGG + Intergenic
985520633 5:372585-372607 CCGCAGTCGCTGCACAGGGCTGG + Intronic
985653933 5:1120238-1120260 CAGAAGACGCTCTCAAGGGCAGG + Intergenic
986111019 5:4717716-4717738 TCACAGCCACTCCAAAGGGCTGG + Intergenic
987258431 5:16179987-16180009 CCTCAGCCGCCTCCACGGGCCGG + Intronic
987658458 5:20839695-20839717 CCACGGCTGCTCTCAAGGGCTGG - Intergenic
988098304 5:26645719-26645741 ACGCGGCCCCTCCCAAGTGCTGG - Intergenic
988671351 5:33385283-33385305 CTGCAGCTGCTCTCATGGGCTGG + Intergenic
988765227 5:34366249-34366271 CCACGGCCGCTCTCAAGGGCTGG + Intergenic
991041114 5:62176628-62176650 TTGCAGCCCCTCCCAGGGGCTGG - Intergenic
993320695 5:86465353-86465375 TCCCAGCCGCTCCCCAGGCCTGG + Intergenic
997387504 5:133485282-133485304 CAGCATCTGCTCCCAAGAGCTGG - Intronic
1001639901 5:173236761-173236783 CCGCAGGCGCGCCCAAGGTGCGG + Intergenic
1002133091 5:177093156-177093178 CCGCAGCAGCGCCCGAGGCCAGG + Exonic
1002300593 5:178255423-178255445 GTGCAGCCGCTCCCAGAGGCTGG - Intronic
1004291820 6:14374398-14374420 ATGCGGCCCCTCCCAAGGGCTGG - Intergenic
1005218523 6:23560015-23560037 CCCCAGCCCCTCCCAAGTGCTGG + Intergenic
1005752151 6:28893604-28893626 CCTCAGCCTCACCCAAGTGCTGG + Intergenic
1006473391 6:34240562-34240584 CCCCAGATGCTGCCAAGGGCGGG - Intronic
1006513679 6:34534607-34534629 CTGCAGCCCCTCCCAGGTGCTGG - Exonic
1007359583 6:41345519-41345541 CAGCACCCGCCACCAAGGGCAGG + Intronic
1007595399 6:43048115-43048137 CCCCAGCCTCTCCCCAGAGCAGG + Intronic
1008104613 6:47428500-47428522 TTGCAGCTGCTCTCAAGGGCTGG + Intergenic
1010913777 6:81590514-81590536 TTGCAGCCCCTCCCAAGTGCAGG + Intronic
1013368621 6:109452603-109452625 CGCCAGCCACTCCCTAGGGCAGG + Exonic
1018575727 6:165258487-165258509 CCACAGCTGCTCTCAAGGGCTGG + Intergenic
1019351290 7:555208-555230 CCTCAGCCCCTCCCCAGAGCGGG - Intronic
1019411247 7:907771-907793 ACGCAGCTGCTGCCAACGGCGGG - Intronic
1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG + Intronic
1021512642 7:21451083-21451105 GTGCAGCCCCTCCCAAGTGCTGG - Intronic
1021991059 7:26142109-26142131 CCGCAGCCCCTCCCAAGTGCTGG - Intergenic
1022505740 7:30907875-30907897 CCTCAGCCACACCCAAGGTCTGG + Intergenic
1024074175 7:45810389-45810411 CCGCAGAGGCTCCCGAGAGCGGG - Intergenic
1025033046 7:55572572-55572594 CAGCAGCCGCGCCCCAGGCCGGG - Intronic
1025053236 7:55745139-55745161 CCGCAGAGGCTCCCGAGAGCGGG + Intergenic
1028833837 7:95352370-95352392 ATGCAGCCCCTCCCAAGTGCTGG + Intergenic
1032220480 7:129990518-129990540 CAGCTGCCTCTCACAAGGGCAGG - Intergenic
1032858880 7:135859091-135859113 TGGCAGCAGCTCCCAGGGGCAGG + Intergenic
1033569289 7:142611887-142611909 GAGCAGCCCCTCCCAAGTGCTGG - Intergenic
1034424325 7:151006754-151006776 CCTCAGCCCCTCCCAAGGGCAGG + Intronic
1034573097 7:151973024-151973046 CCGCAGCTGCTTTCAAGGGCTGG - Intronic
1034575027 7:151989263-151989285 CCTCAGCCTCCCCCAAGAGCTGG + Intronic
1034732088 7:153396762-153396784 TTGCAGCCCCTCCCAAGTGCTGG + Intergenic
1035029700 7:155849110-155849132 CCACAGCTGTTCCCAGGGGCTGG + Intergenic
1035157797 7:156928447-156928469 ACGCAGCCCCTACCAAGTGCTGG + Intergenic
1036597484 8:10227049-10227071 CCACAGCTGCTCCCCAGGGATGG - Intronic
1036662350 8:10716371-10716393 TCACAGCAGCTCCCATGGGCAGG + Intergenic
1037606357 8:20440998-20441020 CCTCAGCCCCTCCCACGTGCTGG + Intergenic
1037769256 8:21789311-21789333 GCGCAGCCGGTCCCCAGGGTGGG - Intronic
1039549008 8:38429925-38429947 CCACAGGGGCTCCCCAGGGCTGG + Exonic
1040742134 8:50589379-50589401 CTGCAAACGCTCCCAAGGGTGGG + Intronic
1044977548 8:97680320-97680342 CCTCAGCCCCTCCAAAGTGCTGG + Intronic
1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG + Intronic
1045535177 8:103020987-103021009 CCGCAGCCGCTGCCACTGCCGGG - Intergenic
1046878007 8:119277516-119277538 CCACAGCTGCTCTCAAGGGCTGG + Intergenic
1049357276 8:142195141-142195163 CCCCAGCTGTCCCCAAGGGCAGG + Intergenic
1049404725 8:142447322-142447344 CCTCAGCCCCTCCCCAGGGAGGG - Intergenic
1049873913 8:145003026-145003048 CCGCAGACTCCGCCAAGGGCTGG - Intergenic
1052880012 9:33596029-33596051 CCACAGCTGCCCCCATGGGCTGG - Intergenic
1053627309 9:39888224-39888246 CTACAGCTGCTCTCAAGGGCTGG + Intergenic
1053663957 9:40304534-40304556 CCGCAGCTGCCCTCATGGGCTGG - Intronic
1053778681 9:41577801-41577823 CCACAGCTGCTCTCAAGGGCTGG - Intergenic
1053914499 9:42935790-42935812 CCGCAGCTGCCCTCATGGGCTGG - Intergenic
1054166643 9:61788041-61788063 CCACAGCTGCTCTCAAGGGCTGG - Intergenic
1054216578 9:62362479-62362501 CTACAGCTGCTCTCAAGGGCTGG - Intergenic
1054376083 9:64450768-64450790 CCGCAGCTGCCCTCATGGGCTGG - Intergenic
1054520657 9:66071751-66071773 CCGCAGCTGCCCTCATGGGCTGG + Intergenic
1054670906 9:67792864-67792886 CTACAGCTGCTCTCAAGGGCTGG + Intergenic
1055530280 9:77177263-77177285 CCCCAGCGGCCCCCCAGGGCGGG - Intergenic
1056971351 9:91207294-91207316 CCTCAGACCCACCCAAGGGCAGG - Intergenic
1056981806 9:91319717-91319739 GTGCAGCCCCTCCCAAGGGCTGG + Intronic
1057226354 9:93295287-93295309 ACGCAGCCGCTCCCCAACGCTGG + Intronic
1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG + Intronic
1058861314 9:109119924-109119946 CCACAGCCGCCCCCGAGGGGCGG + Exonic
1058979746 9:110158060-110158082 CTGCAGCAGCTACCCAGGGCCGG - Intronic
1059901403 9:118930478-118930500 ACGCGGCCCCTCCCAAGTGCTGG + Intergenic
1061422934 9:130481965-130481987 CCGCGCTGGCTCCCAAGGGCAGG - Intronic
1061589466 9:131589278-131589300 GAGCAGCAGCTCCCCAGGGCGGG - Intronic
1062066216 9:134527780-134527802 TCGGAGCCTCTCCCATGGGCAGG + Intergenic
1062312445 9:135946204-135946226 CTGCAGACGCTCCCCAAGGCCGG + Intronic
1062740051 9:138167067-138167089 CCACAGCTGCTCTCATGGGCTGG - Intergenic
1203370335 Un_KI270442v1:297792-297814 CCACAGCTGCTCTCATGGGCTGG + Intergenic
1188115553 X:26238598-26238620 CCACAGCTGCTTTCAAGGGCCGG + Intergenic
1189435692 X:40990828-40990850 CCACGGCTGCTCTCAAGGGCTGG + Intergenic
1189780397 X:44508337-44508359 ATGCAGCCCCTCCCAAGTGCTGG - Intergenic
1189893706 X:45632277-45632299 CCGCAGCTGTTCCCTTGGGCAGG + Intergenic
1192175605 X:68883172-68883194 CCTCAGCCCCTCCCAAAGGTCGG - Intergenic
1194855175 X:98919033-98919055 CTGCAGCTGCTCTCATGGGCTGG - Intergenic
1196302113 X:114059340-114059362 CCGGAGCCGCACCCTGGGGCTGG - Intergenic
1197640232 X:128959406-128959428 CCACAGCTGCTCTCAAGGGCTGG + Intergenic
1200277765 X:154750836-154750858 GCGCAGCCGCTCCCAGCGCCCGG - Intronic
1200306115 X:155027223-155027245 GCTCAGCCGCTCCCAGGGTCCGG + Intronic