ID: 1091155182

View in Genome Browser
Species Human (GRCh38)
Location 11:133365594-133365616
Sequence GTCCATACCTCATGTATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091155174_1091155182 28 Left 1091155174 11:133365543-133365565 CCTGTTGAAGGTCAGGAGTTCAA 0: 1
1: 0
2: 1
3: 29
4: 191
Right 1091155182 11:133365594-133365616 GTCCATACCTCATGTATGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091155182 Original CRISPR GTCCATACCTCATGTATGGT AGG Intronic
900208379 1:1441176-1441198 GTCCCTCCCTCAGGTCTGGTGGG + Exonic
900725408 1:4213321-4213343 GTCCACACCTCATGCTTGGCTGG + Intergenic
906945878 1:50293774-50293796 GTCCTTACTTTATGTATGATGGG - Intergenic
1066003389 10:31125342-31125364 GGCCACACCTCAAGTAGGGTTGG - Intergenic
1076090367 10:127680420-127680442 GTGTATACCTCATGTATGCATGG - Intergenic
1076603343 10:131673616-131673638 GTCCATAGCTGATGGATGGACGG + Intergenic
1081763894 11:45595840-45595862 ATCCAGACCTCAGGTGTGGTGGG + Intergenic
1085628689 11:78094375-78094397 GTCCAACCCACATGTATGGGAGG - Intergenic
1087322191 11:96676735-96676757 CTCCCTACCGCATGTGTGGTTGG + Intergenic
1089760448 11:120718804-120718826 GTTCATACCTCAGGGATGCTTGG + Intronic
1090045086 11:123324451-123324473 ATGCATACCTCATATATAGTTGG + Intergenic
1091155182 11:133365594-133365616 GTCCATACCTCATGTATGGTAGG + Intronic
1096443689 12:51668823-51668845 GTCCATCCCTAACCTATGGTAGG + Intronic
1119625436 14:76170647-76170669 GTCCATACTTCATTTATCGTTGG - Intronic
1122769365 14:104091197-104091219 GTCCCTGTCTCATGTATGGTGGG - Intronic
1141700098 16:85638552-85638574 GTCTCTACCTCATGAATCGTGGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1164079584 19:21851000-21851022 GTCAACACCTCCTGTATGTTGGG + Intronic
1164098475 19:22033018-22033040 TTCAATAGCTCATGTATGTTGGG + Intergenic
1164100313 19:22048933-22048955 GTCAACACCTCCTGTATGTTGGG + Intergenic
1164227574 19:23259260-23259282 GTCAACACCTCCTGTATGTTGGG + Intergenic
1164242411 19:23401110-23401132 GTCAACACCTCCTGTATGTTGGG + Intergenic
1164282922 19:23784935-23784957 GTCAATACCTCCTGTATATTGGG - Intronic
1164294403 19:23896962-23896984 GTCAACACCTCCTGTATGATGGG - Intergenic
1164303563 19:23983273-23983295 GTTAACACCTCATGTATGTTGGG + Intergenic
1165585799 19:36915125-36915147 CTCCATTCCTCATGTGTGGTGGG - Exonic
927666123 2:25034144-25034166 GTCTATATCTGATGTCTGGTAGG - Intergenic
931897142 2:66744857-66744879 GTCCATACTTCATGCTAGGTAGG + Intergenic
935503743 2:103873322-103873344 TTCAATACCTCATTTATGGTTGG + Intergenic
935656508 2:105428260-105428282 GTCCAGACCTCACCTATGGGTGG - Intronic
939096552 2:137839319-137839341 GTGCATACGTCATCTTTGGTGGG - Intergenic
939314547 2:140531041-140531063 TATAATACCTCATGTATGGTAGG - Intronic
940895832 2:159081259-159081281 GTCCATCCCTCATGTAATGGTGG + Intronic
942518938 2:176782681-176782703 GTGGATCCCTCATGAATGGTTGG + Intergenic
943762122 2:191621620-191621642 GTCCCTACCTCAGGTTTTGTGGG + Intergenic
1173043641 20:39489194-39489216 GTCTGTACCTCATGTATGGTTGG + Intergenic
1182035247 22:27193232-27193254 GTGCCTAGCTCAGGTATGGTAGG + Intergenic
949233087 3:1774453-1774475 GTCCATACCCAAAGTATGTTTGG + Intergenic
950179661 3:10902207-10902229 GCCCATACCCCATGTACTGTTGG + Intronic
953771006 3:45778725-45778747 GTGCAGGGCTCATGTATGGTTGG - Intronic
956988043 3:74726916-74726938 GTTAATACCGCATATATGGTTGG + Intergenic
957378241 3:79388849-79388871 CCCCAAACCTCATGTATGATGGG + Intronic
970263822 4:14258907-14258929 GTGAATACCTAATATATGGTGGG + Intergenic
976522279 4:86042356-86042378 GACCATACCTAATGCATGCTGGG + Intronic
987484508 5:18507658-18507680 TTCAATACCTCTTGTAAGGTAGG - Intergenic
991576984 5:68114795-68114817 TTCCATTACTCATGCATGGTTGG - Intergenic
998821950 5:146065193-146065215 GTCAATATCTCATGTTTGTTTGG - Intronic
1000208603 5:159088190-159088212 GCCCATACCTTCTGTATGATAGG - Intronic
1000694784 5:164367365-164367387 GTCCCTGCCTTATGTATGGGGGG + Intergenic
1006215139 6:32435071-32435093 GGCCATAGCTCATCTAGGGTAGG - Intergenic
1008489274 6:52068469-52068491 GTCCATAGCCAATATATGGTGGG - Intronic
1015418420 6:132977641-132977663 GTCCATGACTCATATTTGGTTGG + Intergenic
1016986344 6:149898470-149898492 GGCCCTACCTCATTTCTGGTGGG + Intergenic
1018027013 6:159814509-159814531 GCCCATAGGTCATGTAGGGTGGG - Intronic
1022627233 7:32050212-32050234 GTGTAGACCTCATGTATGTTAGG - Intronic
1023671032 7:42576929-42576951 ATGCATACATCATGTCTGGTGGG + Intergenic
1025782093 7:64610940-64610962 GTCAACACCTCCTGTATGTTGGG - Intergenic
1025785755 7:64642067-64642089 GTCGATACCTCCTGTATGTAAGG - Intergenic
1026269554 7:68824264-68824286 GTGGATCCCTCATGTATGGCTGG + Intergenic
1031034963 7:116778903-116778925 CTCCATGTTTCATGTATGGTAGG - Exonic
1038653318 8:29425626-29425648 TTCCATACCCCCTGGATGGTTGG + Intergenic
1040596787 8:48846415-48846437 GTCCATATCTCAGGTATGGGAGG - Intergenic
1041931525 8:63292456-63292478 GTCTTTACCTCATGTCTGGAAGG + Intergenic
1051805723 9:20990616-20990638 GTCCATACTTCATTTATTGAAGG + Intronic
1061810309 9:133158594-133158616 TTCAATACATCATGTATGATGGG + Intronic
1186078001 X:5901275-5901297 GTGCATAACTCATGTGTGGCAGG + Intronic