ID: 1091158515

View in Genome Browser
Species Human (GRCh38)
Location 11:133397250-133397272
Sequence ATGTTTCCCTTCAATACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091158510_1091158515 28 Left 1091158510 11:133397199-133397221 CCAGTTGGGCTGGATCTTCCAAG 0: 1
1: 0
2: 1
3: 16
4: 111
Right 1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1091158512_1091158515 10 Left 1091158512 11:133397217-133397239 CCAAGAGAATGGTCTATGTCTCT 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1091158508_1091158515 30 Left 1091158508 11:133397197-133397219 CCCCAGTTGGGCTGGATCTTCCA 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1091158509_1091158515 29 Left 1091158509 11:133397198-133397220 CCCAGTTGGGCTGGATCTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 159
Right 1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091158515 Original CRISPR ATGTTTCCCTTCAATACCTA GGG Intronic
901441277 1:9279987-9280009 ATATTTCCCTTCAATTCTTGGGG - Intergenic
902084462 1:13848442-13848464 ATTTTTCCCTTCTAGACCTCTGG - Intergenic
903758599 1:25682198-25682220 ATGTTTCCGTTCAAAACCTGAGG + Intronic
905231299 1:36516302-36516324 ATGTTTCCCTCCAAGCCCCAGGG - Intergenic
909190625 1:72544806-72544828 GTGTTGCTCTTCAACACCTACGG + Intergenic
909905346 1:81187436-81187458 ATGTTTCACTGAAATACCTGAGG + Intergenic
910057286 1:83047835-83047857 GTGTTTCCCTTCAATTCATATGG - Intergenic
910483697 1:87686506-87686528 ATGTTTCCCTTTAGAACCTCTGG + Intergenic
911162972 1:94700128-94700150 ATGTTTCAGTTCAAGACCAAAGG - Intergenic
912218801 1:107648481-107648503 ATGTTTCCCTAAAATATTTAAGG + Intronic
913484216 1:119318998-119319020 CTGTTTCCCATCATTACTTAGGG - Intergenic
916672102 1:167030744-167030766 AATTTTCCCTTCAATATCTTTGG - Intergenic
916742578 1:167659451-167659473 ATGTTTCCCTTTTTTAACTAAGG - Intronic
918327192 1:183421159-183421181 ATGTGTCACTTGAATATCTAGGG + Intergenic
919065855 1:192692298-192692320 ATATTTCCCTTTAATAAATATGG - Intergenic
921752081 1:218807273-218807295 ATGTTTTCCTCAAATATCTAAGG + Intergenic
1064238389 10:13600154-13600176 ATGTTTAACTTCCATAGCTAAGG + Intronic
1065709171 10:28498920-28498942 TTATTTCCCTTAAATACATAGGG + Intergenic
1068393928 10:56436589-56436611 ATTGTTCCCCTAAATACCTAAGG + Intergenic
1069666054 10:70159783-70159805 ATGTTTTACTCCTATACCTACGG + Intronic
1071118070 10:82247079-82247101 ATGTTTCCCCTCACTTCCAAGGG - Intronic
1073395135 10:103211274-103211296 AAGTTTCCATTGAATGCCTAGGG - Intergenic
1074781392 10:116804720-116804742 ATGCTTCCCTTCAAAACCACTGG + Intergenic
1074785859 10:116839091-116839113 ATGTTTGTATTCAATACATAAGG + Intergenic
1075864747 10:125707918-125707940 ATATTTCTCTTCAATGCCTGAGG + Intergenic
1078548668 11:12264853-12264875 ATGGTTCCCTGCTGTACCTAGGG - Intergenic
1080345732 11:31321906-31321928 ATTTTTCCCTTCAGTAACCAGGG - Intronic
1081224667 11:40505356-40505378 GTGTTTCCCTTCTCTACCTCTGG + Intronic
1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG + Intronic
1085211931 11:74789094-74789116 ATGTTTGCCTTCCAAACCTAGGG + Intronic
1087151620 11:94865335-94865357 CTGTCCCCCTTCACTACCTAAGG + Intronic
1088990863 11:114952177-114952199 ATGTTTACCTTCAAAACTTGTGG - Intergenic
1089089132 11:115852690-115852712 TTGTTTCCTTTAAATTCCTAAGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090659935 11:128874771-128874793 CTGTTTCCCATCCATACATAAGG + Intergenic
1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG + Intronic
1091820597 12:3472794-3472816 ATGTTTCTCTTCACCACCCAGGG + Intronic
1093185380 12:16014308-16014330 ATGTTTTCCTTCTAGACCTCTGG - Intronic
1095214025 12:39527169-39527191 ATGTTTCCCTCCTATGCCTCTGG + Intergenic
1105829820 13:24154142-24154164 ATGTTTACCTTCTGTAGCTACGG - Intronic
1107637111 13:42403588-42403610 ATTTTTCCTTACAATGCCTAGGG - Intergenic
1107981882 13:45741840-45741862 ATGTTTCTCTTCAATAATGAAGG - Intergenic
1109171883 13:59107448-59107470 ATTTTTCCCTCCGATGCCTATGG - Intergenic
1109296753 13:60542104-60542126 ATTTTTCCCTTTGATACTTATGG + Intronic
1109686215 13:65823146-65823168 ATTTTTTCCTTCAATACCATTGG - Intergenic
1116288994 14:43007634-43007656 ATGTTCCCCTTCAGTGCCTGGGG - Intergenic
1119588088 14:75857304-75857326 ATGTTACCCTTGCATTCCTATGG + Intronic
1120576829 14:86192365-86192387 ATATTTCTCTTCAATACAGATGG - Intergenic
1124232699 15:27959204-27959226 ATGTTTTCATTCAGTACATATGG + Intronic
1124291983 15:28460531-28460553 ATGTTATCCTTAAATAACTATGG + Intergenic
1130625705 15:85512221-85512243 ATGTTTCTCTTCACCACCTGAGG - Intronic
1130723365 15:86411997-86412019 ATGTCTCCTTTAAAGACCTAGGG - Intronic
1134431365 16:14210817-14210839 TTATTTCCCTTCTATCCCTAGGG + Intronic
1136278847 16:29195640-29195662 ATGTTTCCCTGCAAAACCGAGGG + Intergenic
1138175639 16:54895916-54895938 ATGTTTGCCTTTAATGTCTACGG + Intergenic
1139059628 16:63233047-63233069 AGCTTTGCCTTTAATACCTAAGG + Intergenic
1140698892 16:77563034-77563056 ATGCTTCTCTTTAACACCTATGG + Intergenic
1141288800 16:82698264-82698286 ATGTTTGCCTTCAAAAACAAAGG + Intronic
1142083246 16:88161757-88161779 ATGTTTCCCTGCAAAACCGAGGG + Intergenic
1144931373 17:18861806-18861828 ATGTTTCCCATAAATCTCTAAGG + Intronic
1149749836 17:59135159-59135181 ATGGTTTCCTGCAATACCTAGGG + Intronic
1152384895 17:79966568-79966590 TTGCTTCCCTTCAATCCCCAGGG + Intronic
1155488780 18:26376841-26376863 AGGTTTCCCTTCTATATTTATGG + Intronic
1155950753 18:31910834-31910856 ATGTTCCCCTTCACAACCTTAGG + Intronic
1164435595 19:28226137-28226159 ATTTTTTCCTCCAATACCCAGGG + Intergenic
1167870311 19:52363517-52363539 ATGTTTCCATCCTATACTTAGGG + Intronic
929267241 2:39931614-39931636 ATGTTTCCCTTCCAAATTTATGG - Intergenic
933176285 2:79177169-79177191 ATTTTTCCCACCAATACCTGAGG - Intergenic
933481424 2:82861964-82861986 ATGTTTTATTTCAATACTTAAGG + Intergenic
937744836 2:125399714-125399736 ATGTTTCACATCAATATCTGGGG - Intergenic
939638206 2:144608423-144608445 ATGTTTCCTTTACATTCCTAAGG - Intergenic
1169042411 20:2507419-2507441 ATTTATCCCTTTAATGCCTATGG + Intronic
1169322584 20:4645585-4645607 ATTTTTCCCTTCTAGACCTCTGG + Intergenic
1171299388 20:24046667-24046689 ATGATTCACTTCATAACCTATGG + Intergenic
1172678967 20:36697214-36697236 TTGTTTCCCTTCAAAGCTTAGGG + Intronic
1177364961 21:20123177-20123199 ATGATTTACTTCCATACCTAGGG + Intergenic
1177883136 21:26717913-26717935 CTGGATCCCATCAATACCTAAGG + Intergenic
1179215117 21:39360848-39360870 ATGTTTACATTCAATATGTATGG + Intergenic
952844591 3:37676748-37676770 ATCTTTGTCTTCAAGACCTAAGG + Intronic
952874193 3:37928801-37928823 ATTTTTGCCTTCATTACCTGTGG + Intronic
957583180 3:82102973-82102995 AGGTTTCACTTCAATACATGCGG - Intergenic
959904720 3:111698674-111698696 ATGTTTCCCTCCCATCCATAAGG - Intronic
959965103 3:112345225-112345247 ATGTGTCTCTTCAATACCTTTGG + Exonic
961228807 3:125281173-125281195 ATGTTTCCCTTCCATGACTTTGG - Intronic
962848983 3:139293884-139293906 ATGTTTCCCTTCCCTGCCAAGGG + Intronic
962986669 3:140542520-140542542 ATCTTTCCTTTGAATATCTAGGG - Intronic
970831162 4:20341242-20341264 GTGTTCCCCTTCAGTACCCATGG + Intronic
972653610 4:41044636-41044658 TTGTTTCCTTTGAATACCTTAGG + Intronic
972750566 4:41983565-41983587 ATCTTTCCTTCCAATGCCTATGG - Exonic
977491907 4:97724715-97724737 GTGGTTCACATCAATACCTAAGG - Intronic
977579022 4:98704637-98704659 ATTTTTTCCTTCTATACCTCTGG - Intergenic
978071590 4:104479202-104479224 ATGTTTCTCTTCAATAAAAAAGG - Intronic
978706133 4:111713980-111714002 GTGTTTCCATTGAATTCCTAAGG + Intergenic
978951038 4:114559806-114559828 GTGTGTTCCATCAATACCTAGGG + Intergenic
979094318 4:116526631-116526653 ATGTTTCCTTTAAGAACCTAGGG - Intergenic
982273315 4:153614287-153614309 GTGCTTCCCATCAAGACCTAGGG - Intronic
983463461 4:168056115-168056137 ATCTTTCCCTTCATGAACTAAGG + Intergenic
986397192 5:7342935-7342957 ATGTTTTCCTTCTAGACCTCCGG - Intergenic
988155155 5:27440237-27440259 TTGTTTTCTTTTAATACCTATGG + Intergenic
988659661 5:33251525-33251547 ATGTTTCCCTTCAAACCATGTGG + Intergenic
991438314 5:66618598-66618620 CTGTCTCCCTTCAATACAGAGGG - Intronic
992952110 5:81869693-81869715 TTGTTTCCCTTCACTACCTGTGG + Intergenic
993261762 5:85666653-85666675 TTTTTTCCCTTCAAGACTTAAGG - Intergenic
993398216 5:87416988-87417010 GTGTTTCCATTGAATACATACGG + Intergenic
993675700 5:90813560-90813582 ATGTTTACCTTCCCTACATAAGG + Intronic
994001528 5:94787207-94787229 ATGTTTCTTTTAAATATCTATGG + Intronic
994179677 5:96750459-96750481 ATGATTCTCTTGAATACCTAAGG - Intronic
995144879 5:108775759-108775781 ATGCTGACCTTCACTACCTATGG - Intronic
995737642 5:115319500-115319522 ATTTTTCCCTTCAATGTCTCTGG - Intergenic
1004485396 6:16061569-16061591 ATGGTCCCTTTCAATACCAAGGG + Intergenic
1005836841 6:29716496-29716518 TTTTTTCCCCTCAATACCCAAGG + Intergenic
1006527421 6:34618837-34618859 ATGTATTCATTCAATACCAAGGG + Intronic
1006599936 6:35218670-35218692 TTGTTTCGCTTCTATACCCAAGG - Intronic
1008443139 6:51555998-51556020 ATCTTTCTCTCCAATCCCTAAGG + Intergenic
1008657872 6:53634225-53634247 ATGTTTGCCTTCCTTATCTAAGG + Intergenic
1014309276 6:119780245-119780267 ATGTTTGCCTCCTATATCTATGG + Intergenic
1018347844 6:162921333-162921355 ATGATTCCCTCCAATATCTGTGG + Intronic
1021247675 7:18283762-18283784 ATGTTTCCCATCTATAAATAAGG - Intronic
1023540838 7:41264250-41264272 ATGCTTCCATTCAATGCTTAAGG + Intergenic
1031720922 7:125175025-125175047 ATGTTACCCATCAATACACAAGG - Intergenic
1036057054 8:5267225-5267247 ATGTCCACATTCAATACCTAGGG - Intergenic
1036999380 8:13699429-13699451 ATTTTTTCTTTCAATACATAAGG + Intergenic
1037395576 8:18438364-18438386 ATGTTTTCCTTGCATACCTTTGG + Intergenic
1038263152 8:26015513-26015535 TTGTTTGCCTTCAATAACTTGGG + Intronic
1041113526 8:54510620-54510642 GTGTTTCCTTTCAAAACATAGGG - Intergenic
1044015653 8:87046514-87046536 ATGTTCCCCTCCAATGCCTAGGG + Intronic
1044914291 8:97095811-97095833 ATGTCTCCCTTTAGTATCTAAGG + Intronic
1046499913 8:115062181-115062203 ATGTTTCCCTTAAGCACCTTGGG - Intergenic
1048645280 8:136413051-136413073 ATATTTCCATTGAATAACTAGGG - Intergenic
1052183056 9:25554626-25554648 CTGTGTCCCTTCAATTCCTGTGG + Intergenic
1052312307 9:27080763-27080785 AGGTTTCACTTGAATACCTGAGG - Intergenic
1055008983 9:71542599-71542621 ATGTTTCCCATTAATACATAAGG + Intergenic
1055877398 9:80959838-80959860 ATGTATCCCATTAATACCTATGG - Intergenic
1056882309 9:90407989-90408011 AGGTTTCCTTTCTATACCTATGG + Intergenic
1060060037 9:120451249-120451271 CTGTTTCCCTTCCATTCCCAAGG - Intronic
1186331253 X:8536527-8536549 ATGTTTGCCTTCATTTCCAAAGG + Intronic
1188175010 X:26978128-26978150 GTTTTTCTCTTCAATAGCTATGG + Intergenic
1188652471 X:32649038-32649060 ATGTTTCTCTTCAGTACATTGGG + Intronic
1188759293 X:34005756-34005778 TTGTTTTCCTTCAATATGTATGG - Intergenic
1192539449 X:71955833-71955855 ATGTTTCCCATGAATCCTTAGGG + Intergenic
1193023343 X:76816805-76816827 ATGTTTCAGTTCAACACCAAAGG - Intergenic
1193276452 X:79594017-79594039 ATGCTTACCTTCCATAACTATGG - Intergenic
1197040383 X:121929673-121929695 ATTTTTCCCTTCTATGCCTCTGG - Intergenic
1197081220 X:122419114-122419136 ATGTTTTCCTTCTGAACCTATGG + Intergenic
1197874388 X:131088190-131088212 GTGTTGCCCTTCAACACCTCTGG - Intronic
1198559085 X:137829203-137829225 GTGTTCTCCTTCAGTACCTATGG - Intergenic
1201431358 Y:13906073-13906095 ATGTTTGCCTTCATTTCCAAAGG - Intergenic