ID: 1091161268

View in Genome Browser
Species Human (GRCh38)
Location 11:133423209-133423231
Sequence TGAGGCAATTAAAATGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091161268_1091161271 24 Left 1091161268 11:133423209-133423231 CCTTGATCATTTTAATTGCCTCA 0: 1
1: 0
2: 1
3: 32
4: 408
Right 1091161271 11:133423256-133423278 TTGTCTTCAGTTTTAGCAATTGG 0: 1
1: 0
2: 0
3: 28
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091161268 Original CRISPR TGAGGCAATTAAAATGATCA AGG (reversed) Intronic
900056357 1:633916-633938 TGTGGCAATAAAAATGATTAAGG - Intergenic
903073685 1:20744581-20744603 TGCAGAAATTAAAATGAACAAGG + Exonic
906583697 1:46957210-46957232 TGAAGCAGTTAAAATGATACAGG + Intergenic
907655262 1:56335565-56335587 TGTGGCATTTGAAATGGTCAGGG - Intergenic
908720164 1:67116907-67116929 TAAGGGAATTAAAATCAACAGGG - Intronic
908978442 1:69925650-69925672 AGACGCAATAAAAATGATAAAGG - Intronic
909390018 1:75109710-75109732 AGATGCAATAAAAATGATAAAGG - Intergenic
909557233 1:76967436-76967458 AGATGCAATAAAAATGATAAAGG - Intronic
910591322 1:88930202-88930224 TGAAGCAGTTAAAATGATACAGG + Intergenic
910741250 1:90520106-90520128 TGTGTCAATTTAAATAATCATGG - Intergenic
910804772 1:91179447-91179469 TGAAGCAGTTAAAATGATACAGG + Intergenic
911016169 1:93335311-93335333 TTATGAATTTAAAATGATCAAGG + Intergenic
911036365 1:93553495-93553517 TGAGGAAATTAAAATGGACTTGG - Exonic
911586130 1:99692999-99693021 AGTGACAATTAAAATAATCATGG + Intronic
911694400 1:100872623-100872645 TGAGAATATTAAAATAATCATGG - Exonic
912224431 1:107717088-107717110 AGATGCAATAAAAATGATAAAGG - Intronic
913412756 1:118571076-118571098 AGATGCAATAAAAATGATAAAGG - Intergenic
914391848 1:147230859-147230881 AGATGCAATAAAAATGATAAAGG - Intronic
914808010 1:151005857-151005879 TGAGGGAGTTAAAATAATCCTGG + Intronic
915653709 1:157340005-157340027 AGATGCAATAAAAATGATAAAGG - Intergenic
915771485 1:158429859-158429881 AGATGCAATAAAAATGATGAAGG - Intergenic
916013691 1:160729339-160729361 TGAGGTAATAAGAATGAACATGG + Intergenic
916477875 1:165186937-165186959 TGAGGCAGTTGAAATAATTAAGG - Intergenic
916924235 1:169500975-169500997 AGACGCAATAAAAATGATAAAGG + Intergenic
918159574 1:181885501-181885523 AGATGCAATAAAAATGATAAAGG + Intergenic
919300875 1:195763669-195763691 TGAGCCACTTAAAATGATGCAGG - Intergenic
919413658 1:197278823-197278845 TTAAGCAGTTAAAATGAGCAAGG + Intronic
919699355 1:200615635-200615657 TCAAGTAACTAAAATGATCAAGG + Intronic
922684408 1:227628129-227628151 TGAAGCAGTTAAAATGATACAGG - Intronic
923393025 1:233532523-233532545 TGAGGCAAACATAATGATAAGGG - Intergenic
924889229 1:248256006-248256028 AGATGCAATAAAAATGATAAAGG + Intergenic
1062809384 10:450844-450866 TGAGGCAACTAAAAAGACGAAGG + Intronic
1062985897 10:1768290-1768312 AGACGCAATAAAAATGATAAAGG - Intergenic
1063239552 10:4153787-4153809 TGAGGCCTTTAAAATGAGCAGGG - Intergenic
1064479759 10:15727449-15727471 GGAGATAATTAAAATGGTCAAGG - Intergenic
1064642910 10:17432368-17432390 TGAGGCAATTACAACAATCCGGG + Intronic
1064763229 10:18643700-18643722 TAAGGCTATCAAAATGATGAAGG - Intronic
1064975304 10:21108018-21108040 AGATGCAATAAAAATGATAAAGG - Intronic
1065135694 10:22667131-22667153 TAAGGCATTTTACATGATCAGGG - Intronic
1066965493 10:42260629-42260651 AGATGCAATAAAAATGATAAAGG - Intergenic
1067191882 10:44077609-44077631 AGATGCAATAAAAATGATAAAGG - Intergenic
1068195169 10:53706662-53706684 AGATGCAATAAAAATGATAAAGG - Intergenic
1068256511 10:54518352-54518374 AGACGCAATAAAAATGATAAAGG + Intronic
1069377485 10:67808538-67808560 TGATACAAAGAAAATGATCATGG + Intronic
1069584643 10:69590128-69590150 TGAGCCAATAAAAATAATAAGGG + Intergenic
1071323475 10:84488590-84488612 AGACGCAATTAAAATGATACAGG - Intronic
1071748301 10:88446605-88446627 AGATGCAATAAAAATGATAAAGG + Intronic
1072975884 10:100057427-100057449 TGTGGCAATAAAAATAATCAGGG + Intronic
1073177849 10:101567353-101567375 TGGGGCAGTTATAATGATGAAGG + Intergenic
1074484497 10:113861133-113861155 TAAGGCAATGGAAATGATTAAGG + Intronic
1075228615 10:120651711-120651733 GGTGGCAATCAAAAAGATCAAGG - Intergenic
1076544421 10:131235235-131235257 TAAGGCAATTTCAATGATGATGG + Intronic
1077388495 11:2287493-2287515 TGAGGCAACTAGAATTTTCAGGG + Intergenic
1079485789 11:20934870-20934892 TGAGGCATAAAAGATGATCAGGG + Intronic
1079757419 11:24281919-24281941 AGATGCAATAAAAATGATAAAGG - Intergenic
1080025705 11:27612128-27612150 TTAGGCAAGTGAGATGATCAAGG - Intergenic
1080379907 11:31758029-31758051 TTAGAAAATTATAATGATCAGGG - Intronic
1080554974 11:33407647-33407669 TGAAGGAATTAAAAGGATTAGGG - Intergenic
1080919969 11:36699136-36699158 TGAAGCAATCAAAATAATTATGG + Intergenic
1081067398 11:38562564-38562586 TGAAGCAATTAAGATGTTTATGG - Intergenic
1081104042 11:39042394-39042416 AAAGGAAATTAAAATGATCTAGG - Intergenic
1081428025 11:42946399-42946421 TGAGGGAATTAAAATGAGAATGG + Intergenic
1082587202 11:54955564-54955586 AGATGCAATAAAAATGATAAAGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1084852616 11:71955027-71955049 TGAGGGAACTAATATGTTCATGG + Intronic
1085248273 11:75122599-75122621 CGATGCAATAAAAATGATAAAGG + Intronic
1085662255 11:78379372-78379394 TGAGTCAATTAAAATGTCCTTGG + Intronic
1088174926 11:107041923-107041945 TGAGGCAAATAAAATAATACAGG + Intergenic
1088265303 11:107982800-107982822 TGAAGCAGTTAAAATGATACAGG - Intergenic
1088857291 11:113767549-113767571 AGAGGCAGTTAAAATAATCGAGG - Intronic
1089967552 11:122665852-122665874 TGAGGCAAATAGATTGCTCAGGG + Intronic
1090493013 11:127182110-127182132 AAAAGCAAATAAAATGATCAAGG - Intergenic
1091161268 11:133423209-133423231 TGAGGCAATTAAAATGATCAAGG - Intronic
1093328441 12:17807772-17807794 AGATGCAATAAAAATGATGAAGG + Intergenic
1093329488 12:17817380-17817402 AGATGCAATAAAAATGATAAAGG - Intergenic
1095067010 12:37790200-37790222 AGATGCAATAAAAATGATAATGG + Intergenic
1095185382 12:39195126-39195148 AGATGCAATAAAAATGATAAAGG - Intergenic
1095244146 12:39899331-39899353 AGATGCAATAAAAATGATAAAGG - Intronic
1095442497 12:42251755-42251777 AGATGCAATAAAAATGATAAAGG - Intronic
1095558626 12:43538689-43538711 TAAAGCCATTTAAATGATCATGG + Intronic
1096351795 12:50906901-50906923 TGAAGCAGTTAAAATGATACAGG - Intergenic
1097156245 12:57014306-57014328 AGAGACAATAACAATGATCATGG + Intronic
1097276698 12:57818504-57818526 TGAGGCTTTTAAAATGAACCAGG - Intronic
1097376975 12:58853973-58853995 TGAAGCAGTTAAAATGATACAGG - Intergenic
1098004385 12:65980509-65980531 AGATGCAATAAAAATGATAAAGG + Intergenic
1099118720 12:78661022-78661044 TGTGGAGAGTAAAATGATCAAGG + Intergenic
1099142300 12:78994259-78994281 TGGTGCAATTGAAATGATAAAGG - Intronic
1099314553 12:81067869-81067891 AGATGCAATAAAAATGATAAAGG + Intronic
1099576427 12:84389783-84389805 TGAGGCCATTAAAATGACTTTGG + Intergenic
1099858124 12:88195100-88195122 TGAGGCCCTTGATATGATCAGGG - Exonic
1099911006 12:88833401-88833423 TGTGGGAATTAAGATGATAAAGG - Intergenic
1100749603 12:97682648-97682670 TGAGGCAGCTAAAACGTTCAGGG + Intergenic
1101702526 12:107188347-107188369 AGATGCAATAAAAATGATAAAGG + Intergenic
1103803390 12:123554204-123554226 TGAAGCAGTTAAAATGATACAGG + Intergenic
1105905859 13:24809491-24809513 AGACGCAATAAAAATGATAAAGG - Intronic
1105909415 13:24848006-24848028 TTAGGCTTTTAAAATGATAATGG - Intronic
1106424609 13:29614036-29614058 AGAGGAAATTAAAATCCTCATGG - Intergenic
1106526478 13:30545170-30545192 CGAGGCATTTAAAATGCTGATGG + Intronic
1106986860 13:35363477-35363499 TGAGGAAATTGAAGTAATCAGGG - Intronic
1107198828 13:37688807-37688829 TGAGACAATTAACATGATGAGGG + Intronic
1108860824 13:54856893-54856915 AGACGCAATAAAAATGATAAAGG + Intergenic
1110049349 13:70874797-70874819 TGAGGCAATAACAATGAGTAAGG - Intergenic
1111656346 13:91158623-91158645 TGAAGCAATGAAAATGGCCATGG - Intergenic
1112515534 13:100050067-100050089 TGAGCCAATACAAATGACCATGG + Intergenic
1113514343 13:110880892-110880914 TCCAGCAATTAAAATGACCATGG + Intronic
1113597146 13:111541177-111541199 TGAGGCAATTAAATTTTCCACGG - Intergenic
1114009384 14:18350868-18350890 AGATGCAATAAAAATGATAAAGG + Intergenic
1115769040 14:36651698-36651720 TGTGTCAATAAAAATGATGAAGG - Intergenic
1116359286 14:43972633-43972655 TGAGACTATTAAAATAATCCCGG + Intergenic
1116589904 14:46759343-46759365 CATGGCAATTGAAATGATCAAGG - Intergenic
1116678690 14:47938804-47938826 TGGGGCAGGCAAAATGATCAGGG - Intergenic
1117579753 14:57140213-57140235 TTTGGCAATGAAAATGAGCAGGG - Intergenic
1117923071 14:60745729-60745751 TGAGGCAAAGAAAATAAACAGGG - Intronic
1118143341 14:63109203-63109225 AGATGCAATAAAAATGATAAAGG - Intergenic
1118285651 14:64469084-64469106 TGAAGAAATTGAAACGATCAAGG + Exonic
1118625963 14:67659368-67659390 TGAGAGAATAAAAAAGATCAAGG + Intronic
1120378205 14:83736937-83736959 TGAGACAATGAAAATAATGAAGG + Intergenic
1120380455 14:83771973-83771995 TAAGGTAAATATAATGATCAGGG - Intergenic
1121436734 14:93925595-93925617 TCTGGCACTTAAAATGATGATGG + Intronic
1122580343 14:102767856-102767878 TCAGTCAATAAAAATGATCATGG - Intergenic
1123428938 15:20197751-20197773 AGATGCAATAAAAATGATAAAGG - Intergenic
1123883477 15:24698147-24698169 TGAAGCAAGCAAAATTATCAAGG - Intergenic
1125358124 15:38837787-38837809 AGACGCAATAAAAATGATAAAGG - Intergenic
1125837652 15:42767404-42767426 AGACGCAATAAAAATGATAAAGG + Intronic
1126306455 15:47263737-47263759 TGTGGCCATAAAAATGAACACGG - Intronic
1126905893 15:53364992-53365014 TAATACAAGTAAAATGATCAGGG - Intergenic
1127411741 15:58714974-58714996 AAAGGTAATTAAAATGACCACGG + Intronic
1127746068 15:61974959-61974981 TGAGGCAATTACATTGAGTAGGG - Intronic
1128148908 15:65349015-65349037 TGGGGAAAGTGAAATGATCAGGG - Intronic
1128784824 15:70387090-70387112 TGAATTAATAAAAATGATCACGG - Intergenic
1128913489 15:71538356-71538378 TGAGTCACTTCAAATCATCAAGG - Intronic
1130453619 15:84081406-84081428 TAAGGCATTTGAAATGAACACGG + Intergenic
1131420462 15:92300508-92300530 TGAAGCAGTTAAAATAATAATGG + Intergenic
1134640383 16:15825245-15825267 TGAGGCTATAAAAATGCTCTGGG + Intronic
1140592871 16:76374125-76374147 TTAGGTACTTAAAATGCTCATGG - Intronic
1143238498 17:5423593-5423615 TGTGGCACTTAAAATGAATAGGG - Intronic
1143372787 17:6450644-6450666 TGAGGCAAATAGAAGGCTCAAGG - Exonic
1148224882 17:45892414-45892436 TGACATAATTAAAATGATCTGGG + Intergenic
1153401830 18:4690355-4690377 TGAAGCAGTTAAAATGATACAGG + Intergenic
1153511506 18:5858905-5858927 AGACGCAATAAAAATGATAAAGG - Intergenic
1153541166 18:6157346-6157368 TGAAGCAATTAATATGATGATGG - Intronic
1153648288 18:7214900-7214922 TGAGGCAATAAAAATGACCTAGG - Intergenic
1155663017 18:28274393-28274415 TGAGTCCATTAAATTGCTCAAGG + Intergenic
1155857033 18:30847111-30847133 TGACACAATAAAAATGATAAAGG - Intergenic
1156391786 18:36657722-36657744 TGAGGCAAGAAAAATCTTCATGG + Intronic
1156522526 18:37733862-37733884 TGAGGCAATTGGAAAGATGAAGG + Intergenic
1157263970 18:46200761-46200783 TGATGTAATCAAAATGAGCAGGG - Intronic
1158511991 18:58098640-58098662 TGAGGAAATGACAATGATGATGG - Intronic
1160601722 18:80018626-80018648 AGACGCAATAAAAATGATAAAGG + Intronic
1160670191 19:358618-358640 TGGGTGAAATAAAATGATCAGGG - Intergenic
1162663833 19:12193350-12193372 TGAGGTAATGAAAATGTTCTAGG + Intergenic
1164633122 19:29774530-29774552 TGAGACAGTTTAAATGATCATGG + Intergenic
1202632189 1_KI270706v1_random:10693-10715 AGACGCAATAAAAATGATAAAGG - Intergenic
925255878 2:2487441-2487463 TGTGGCAATGCAAATGGTCAAGG - Intergenic
926607091 2:14908641-14908663 TGTGACAATTAACATAATCATGG + Intergenic
926640748 2:15233763-15233785 TGGGGTAATTAAACTGATAAAGG + Intronic
927804235 2:26131622-26131644 TGAGGGAATTAAAGGGAACAAGG - Intronic
928677373 2:33662779-33662801 TGAAGCAGTTAAAATGATACAGG + Intergenic
928811851 2:35237041-35237063 AGATGCAATAAAAATGATAAAGG + Intergenic
928976192 2:37088948-37088970 GAAGGCAATAAAAAGGATCAAGG - Intronic
930276248 2:49314715-49314737 AGATGCAATAAAAATGATAAAGG + Intergenic
930290158 2:49483615-49483637 AGATGCAATAAAAATGATAAAGG + Intergenic
931840349 2:66141793-66141815 AGAGGCAATAAAAATGATAAAGG - Intergenic
931874496 2:66497172-66497194 AGAGACAATGATAATGATCAAGG - Intronic
932742388 2:74301615-74301637 TGAGGCAGGTAAAATGATTCTGG + Intronic
933021511 2:77199308-77199330 TGAGGGAATTAAAACTATAAAGG + Intronic
933289117 2:80417837-80417859 TGAGCAACTTAAAATTATCAAGG - Intronic
934011540 2:87825323-87825345 TGTGGCAATAAAAATGATTAAGG - Intronic
934314530 2:91904620-91904642 AGATGCAATAAAAATGATAAAGG + Intergenic
935412859 2:102784197-102784219 TGGGGAAATTGACATGATCAAGG - Intronic
935515640 2:104034901-104034923 TGAGGCAACTAAAATGTGAAAGG - Intergenic
935748970 2:106213654-106213676 TGAAGCAGTTAAAATGATATAGG + Intergenic
936642969 2:114336367-114336389 AGATGCAATAAAAATGATAAAGG + Intergenic
937202241 2:120211273-120211295 TGAGGCAATGAAGATAATTAGGG - Intergenic
938651248 2:133385897-133385919 AGATGCAATAAAAATGATAAAGG - Intronic
938826044 2:135006489-135006511 TACGACAATTAAAATGAACAAGG - Intronic
940400986 2:153247853-153247875 AGAGACAATAAAAATGATAAAGG + Intergenic
940550989 2:155156415-155156437 TTAAGCAATTGAAATAATCAGGG - Intergenic
940565440 2:155354334-155354356 TGAGTTAATTAAACTGAACAAGG + Intergenic
940578272 2:155542762-155542784 TGAGACAAGTGAAATGATAATGG - Intergenic
941991501 2:171561651-171561673 TGAAGCAGTTAAAATGATACAGG - Intergenic
942218096 2:173742157-173742179 TGAGGAAAAAAAAATGACCAGGG + Intergenic
942362197 2:175183773-175183795 TGAGGCCATAAAGATGAACAGGG + Exonic
942809641 2:179982729-179982751 TGAGGCTTTTAAAACAATCAAGG + Intronic
943109651 2:183589466-183589488 AGACGCAATAAAAATGATAAAGG + Intergenic
943378479 2:187112170-187112192 TGTGGCAGTTGAAATCATCATGG + Intergenic
943549598 2:189322468-189322490 AGACGCAATAAAAATGATAAAGG + Intergenic
944254512 2:197611462-197611484 AGACGCAATAAAAATGATAAAGG - Intronic
944378274 2:199074885-199074907 TGACACAATAAAAATGATAAAGG + Intergenic
944711058 2:202335685-202335707 TGAGGCAAATACAAGGCTCAAGG + Intergenic
946129183 2:217592522-217592544 TGAAGCAATTAAAATGATACAGG - Intronic
946460940 2:219868370-219868392 TGAGGAAATTATAATTAACAGGG - Intergenic
946738292 2:222776319-222776341 TGTGGTACTGAAAATGATCATGG - Intergenic
946931808 2:224678464-224678486 TGATGCAATAAAAAAGATTAAGG + Intergenic
1169474737 20:5920833-5920855 TGAGGCAATGAAAATGTCCCTGG - Intronic
1169838343 20:9905941-9905963 TGGAGAAATTAAAATGAACAAGG + Intergenic
1170089898 20:12579388-12579410 TGAGTAAAATAAAATGATCAAGG - Intergenic
1170606954 20:17881944-17881966 TGAGGCCAGGAAAATGGTCAAGG + Intergenic
1174694820 20:52546537-52546559 AGACGCAATAAAAATGATAAAGG + Intergenic
1178142367 21:29698861-29698883 TGTGCCATTTAAAATGATAAGGG + Intronic
1178292833 21:31384182-31384204 TAAGGCAATTAAGATACTCAAGG + Intronic
1180323364 22:11344695-11344717 AGATGCAATAAAAATGATAAAGG + Intergenic
1180368542 22:11962661-11962683 AGACGCAATAAAAATGATAAAGG + Intergenic
1180433884 22:15281677-15281699 AGATGCAATAAAAATGATAAAGG + Intergenic
1180524118 22:16238328-16238350 AGACGCAATAAAAATGATAAAGG + Intergenic
1180541298 22:16450502-16450524 AGATGCAATAAAAATGATAAAGG + Intergenic
1183009183 22:34930922-34930944 TGAGGGAAGGAAAATGATGATGG - Intergenic
1185189543 22:49425898-49425920 GTAAGCAATTTAAATGATCAAGG - Intronic
949695628 3:6691691-6691713 TACAGCAATTAAAATGATAAAGG + Intergenic
950348585 3:12323775-12323797 TAAGGCCATTAGAATGTTCAAGG + Intronic
951471315 3:23059466-23059488 AGATGCAATAAAAATGATAAAGG - Intergenic
955787020 3:62551429-62551451 GGAGGCTATTAAAATAATCCAGG - Intronic
957679833 3:83419433-83419455 AGAGCCTATTAAAATAATCATGG + Intergenic
957913381 3:86652988-86653010 TGAGGCAATTATAAAGTTCATGG - Intergenic
958651248 3:96939456-96939478 AGATGCAATAAAAATGATAAAGG - Intronic
959557989 3:107745359-107745381 AAAGACAATTCAAATGATCAAGG - Intronic
960789713 3:121415073-121415095 TGATGCAATTAAAATCATACTGG + Intronic
960934886 3:122892722-122892744 TGAGGCAATCAAAATGTGCCAGG - Intergenic
961395821 3:126588827-126588849 TGATGCAATAAAAATGATAAAGG - Intronic
962703745 3:138023799-138023821 TGAGACAATGAACATGATCCCGG - Exonic
962756018 3:138465812-138465834 TGAGAGGACTAAAATGATCAGGG + Intronic
963978123 3:151505788-151505810 AAAGGCAAATAAAATGATTAAGG + Intergenic
964334201 3:155637609-155637631 TGAGGAAATAAAAATGATAAGGG - Intronic
964433612 3:156630130-156630152 TGAGGCAAGTAAAAAGCCCAGGG + Intergenic
966030508 3:175340699-175340721 AGATGCAATTAACATGATCATGG + Intronic
966962666 3:184955434-184955456 TGAAGCAAGTCACATGATCATGG - Intronic
968177046 3:196559595-196559617 TGATGCTATTAAAAAGAACATGG + Intronic
969645248 4:8424533-8424555 TGAAGCAGTTAAAATGATACAGG + Intronic
969711544 4:8847088-8847110 TGTGGCAATGCAAATGGTCAGGG - Intronic
970071694 4:12166666-12166688 TGAGGCTATGAAAAAGAACAAGG - Intergenic
970439679 4:16069486-16069508 TGATGCTTTTAAAATGACCATGG - Intronic
971555385 4:28007288-28007310 GGAGGTTATTAAAATGAACAAGG + Intergenic
972067795 4:34972436-34972458 TCAGGCAATTGAAAGGATAATGG - Intergenic
973652451 4:53009766-53009788 AAATGCAATTAAAATGATAAAGG - Intronic
973879402 4:55254036-55254058 TGAGGCATTCAAAGTTATCAAGG + Intergenic
974284362 4:59845088-59845110 AGATGCAATAAAAATGATAAAGG + Intergenic
974759543 4:66257121-66257143 AGATGCAATAAAAATGATAAAGG - Intergenic
975001999 4:69236259-69236281 AGACACAATAAAAATGATCAAGG + Intergenic
975247860 4:72141109-72141131 AGACGCAATAAAAATGATAAAGG - Intronic
975753267 4:77546597-77546619 AGATGCAATAAAAATGATAAAGG - Intronic
976026208 4:80690834-80690856 AGACGCAATAAAAATGATAAAGG + Intronic
976083712 4:81385744-81385766 AGATGCAATAAAAATGATAAAGG + Intergenic
976272374 4:83244089-83244111 AGATGCAATAAAAATGATAAAGG + Intergenic
976553445 4:86423046-86423068 TCATGCAACTAAAATGAGCATGG + Intronic
976725570 4:88212709-88212731 GGATGTAATTATAATGATCATGG - Intronic
976761543 4:88554462-88554484 TGAGGTAAATAAAATGATTGAGG + Intronic
977562105 4:98543172-98543194 AGAGTCAATGAAAATGATGAGGG - Intronic
977946760 4:102922697-102922719 AGATGCAATAAAAATGATAAAGG + Intronic
978097446 4:104795598-104795620 TAAGGCAGTGAAAATAATCAGGG + Intergenic
978270458 4:106883294-106883316 AGATGCAATAAAAATGATAAAGG - Intergenic
978586513 4:110280874-110280896 TGAAGCAGTTAAAATGATACAGG - Intergenic
978611863 4:110550419-110550441 TGAGCCAATTAGAATTATCTGGG + Intronic
978664589 4:111167326-111167348 AGATGCAATAAAAATGATAAAGG + Intergenic
979622819 4:122814465-122814487 TGTTGCAGTTAAAATGAGCAAGG + Intergenic
979908648 4:126332143-126332165 GGAGGCAAATAAAAGAATCAAGG + Intergenic
980037528 4:127902355-127902377 AGATGCAATAAAAATGATAAAGG - Intergenic
980223408 4:129948449-129948471 TGAAGAAATTGAAATAATCAAGG - Intergenic
980765353 4:137296219-137296241 TGAGGCTGTTAAAATAATCCAGG + Intergenic
980936713 4:139232792-139232814 TAAGACAGTTAAAATGATAATGG + Intergenic
981215174 4:142156988-142157010 TAAGCCAATTTAAGTGATCAGGG + Intronic
981257129 4:142675140-142675162 AGATGCAATGAAAATGATAAAGG + Intronic
981326029 4:143448641-143448663 AGATGCAATAAAAATGATAAAGG - Intronic
981365003 4:143892160-143892182 AGATGCAATAAAAATGATAAAGG - Intronic
981514646 4:145594168-145594190 AGACGCAATAAAAATGATAAAGG - Intergenic
981604991 4:146530787-146530809 AGATGCAATAAAAATGATAAAGG + Intergenic
981789350 4:148518753-148518775 TGACACAATAAAAATGATAAAGG - Intergenic
981846822 4:149179127-149179149 AGATGCAATAAAAATGATAAAGG + Intergenic
981879686 4:149594307-149594329 AGATGCAATAAAAATGATAAAGG - Intergenic
982653672 4:158119317-158119339 AGATGCAATAAAAATGATAAAGG - Intergenic
982852653 4:160339331-160339353 AGATGCAATAAAAATGATAAAGG - Intergenic
982925023 4:161325844-161325866 GTAGGCAATTAAAATGAACCTGG + Intergenic
983668572 4:170210408-170210430 AGATGCAATAAAAATGATAAAGG + Intergenic
983678076 4:170319678-170319700 AGACGCAATAAAAATGATAAAGG + Intergenic
983841160 4:172458512-172458534 AGAGGCAATAAAAATGATAAAGG + Intronic
984724021 4:183002708-183002730 TGAAGCAGTTAAAATGATACAGG + Intergenic
985473500 5:62952-62974 AGAAGCAATAAAAATGATAAAGG - Intergenic
985610540 5:885489-885511 TGAGGCAATTGTGATGGTCACGG - Intronic
987180189 5:15359410-15359432 AGATGCAATAAAAATGATAAAGG + Intergenic
987809791 5:22820525-22820547 AGATGCAATAAAAATGATAAAGG + Intronic
987955040 5:24728171-24728193 TGGGGATATTAAAATCATCATGG + Intergenic
988667976 5:33351012-33351034 AGATGCAATAAAAATGATAAAGG - Intergenic
989768910 5:45119150-45119172 AGATGCAATAAAAATGATAAAGG + Intergenic
991161682 5:63510606-63510628 AGATGCAATAAAAATGATAAAGG + Intergenic
991571824 5:68062969-68062991 AGATGCAATAAAAATGATAAAGG + Intergenic
991652767 5:68873105-68873127 TCAGGTAAGTAAAATGATAAAGG - Intergenic
992197789 5:74356852-74356874 TTAGGCCATTTAAATGAGCATGG + Intergenic
992614033 5:78532809-78532831 AAAGGCAAGTGAAATGATCATGG - Intronic
993060598 5:83034411-83034433 TGAGGAAATTAAAATGTATAAGG + Intergenic
993244973 5:85439337-85439359 GGTAGCAATTAAAATAATCAGGG + Intergenic
993438025 5:87921829-87921851 AGATGCAATAAAAATGATAAAGG - Intergenic
993566835 5:89487024-89487046 TGAGGGAATGTAAATGAGCATGG - Intergenic
994711763 5:103274009-103274031 TGAGGCAAAAAAAATAACCAGGG - Intronic
995442801 5:112210787-112210809 GGAGGCAGTTTAGATGATCAGGG + Intronic
995665148 5:114533503-114533525 AGACGCAATAAAAATGATAAAGG - Intergenic
995937147 5:117530449-117530471 AGACGCAATAAAAATGATAAAGG - Intergenic
996496166 5:124159202-124159224 AGAGGTCATAAAAATGATCATGG + Intergenic
997086317 5:130804362-130804384 TGAATCATTTAAAATGATTAAGG + Intergenic
1001372326 5:171217753-171217775 AGATGCAATAAAAATGATAAAGG - Intronic
1001593465 5:172882261-172882283 TGGGGAAATGAAAGTGATCAAGG - Intronic
1002084636 5:176766053-176766075 TGAGGAATTTAAAATAACCATGG - Intergenic
1002635829 5:180608306-180608328 TGAAGCAAGTCACATGATCATGG - Intronic
1002890938 6:1331261-1331283 TGAAGCAGTTAAAATGATACAGG - Intergenic
1003215724 6:4108844-4108866 TGAGGAAATTAAAATGGACTTGG - Intronic
1004006281 6:11640140-11640162 TGGTGCAGTTAAAATGATCAGGG + Intergenic
1004612692 6:17259761-17259783 AGAGGCAGTTAAAAAAATCATGG - Intergenic
1004937208 6:20519310-20519332 TGAGGCAATTTAGATGTTCTAGG - Intergenic
1005846398 6:29783034-29783056 AGATGCAATAAAAATGATAAAGG + Intergenic
1006213942 6:32422534-32422556 AGATGCAATAAAAATGATAAAGG - Intergenic
1008284774 6:49635727-49635749 TGAGGGAATTAATATGATGGGGG - Intronic
1008655432 6:53607618-53607640 TGTGCCAATTAAAATGAACATGG - Intronic
1008690615 6:53974667-53974689 TGAGACAATCACAATGATCCAGG - Intronic
1010442654 6:75915427-75915449 TAAACCACTTAAAATGATCAAGG + Exonic
1010785801 6:79999662-79999684 TTTGGCAAATAAAATGATAAAGG - Intergenic
1011062719 6:83289982-83290004 AGATGCAATAAAAATGATAAAGG - Intronic
1011858657 6:91727030-91727052 TGCGGCAATAAAAATAATTAGGG - Intergenic
1011953631 6:92998443-92998465 AGATGCAATAAAAATGATAAAGG + Intergenic
1012098700 6:95000491-95000513 TGAGGCAAGTGAAAAGATTAAGG - Intergenic
1012332568 6:98010985-98011007 AGATGCAATAAAAATGATAAAGG - Intergenic
1012623349 6:101376438-101376460 TGAGGCCATTTGAATGCTCAAGG + Intergenic
1012784310 6:103603795-103603817 AGAGGCAATAAAAATGATAAAGG - Intergenic
1013388905 6:109663238-109663260 TAAGGAAATTAATATGATGATGG - Intronic
1013683298 6:112548984-112549006 TGAGGAAATTAAAATTTTCCTGG + Intergenic
1013817018 6:114110738-114110760 TGAGGCTATTAAAAGTGTCATGG + Intronic
1015695139 6:135971475-135971497 GGAGTCAATTTTAATGATCAGGG + Intronic
1016422116 6:143896334-143896356 TTAGGCAAAGACAATGATCATGG - Intronic
1017983252 6:159421126-159421148 TGAGGGAATAGAAATGACCAAGG - Intergenic
1018614060 6:165669338-165669360 TGAGCCAAATAAAATGAATATGG - Intronic
1018906275 6:168078113-168078135 TGTGGCAATTAAAATGAGAGTGG - Intronic
1019005574 6:168793851-168793873 GGAGACCATTAAAATGATGATGG - Intergenic
1019707658 7:2504184-2504206 TGAGACAATTATAATGGTCATGG + Intergenic
1020949748 7:14660569-14660591 AGACGCAATAAAAATGATAAAGG - Intronic
1021143839 7:17060769-17060791 TGAGGAAATTAAAAAGATGAAGG - Intergenic
1021336410 7:19408105-19408127 TGAGGCTATTACAATAATCCAGG - Intergenic
1021926892 7:25542435-25542457 AGAAGAAATTAAAATGAGCAAGG - Intergenic
1022711907 7:32858976-32858998 TGAGGAAATGAAAACGATCATGG - Intergenic
1022804990 7:33812581-33812603 TCAGGAAATTAAAATCATGATGG - Intergenic
1023136087 7:37053606-37053628 TGAGGCAAGTATATTTATCACGG + Intronic
1023669153 7:42557946-42557968 TGAGGCAACTACCATAATCAAGG - Intergenic
1024050250 7:45616439-45616461 TGAGGCATTTAATGTGATCCTGG - Intronic
1024718097 7:52103773-52103795 AGATGCAATAAAAATGATAAAGG + Intergenic
1026145014 7:67739162-67739184 TGAGGTAATGAAAATGTTCTCGG + Intergenic
1026348777 7:69497682-69497704 GGAGGCAATTATGATGATGAGGG + Intergenic
1028050332 7:86177217-86177239 AGATGCAATAAAAATGATAAAGG + Intergenic
1028066945 7:86397299-86397321 TGAAGCATTTAAAAGGAACATGG + Intergenic
1028144606 7:87307707-87307729 TGACTCAATAAAAATGATAAAGG + Intergenic
1028172211 7:87611753-87611775 TGTTGCAAATAAAATAATCAGGG + Intronic
1028825395 7:95266905-95266927 GGAGGAAATTAAAGTGATCAAGG + Intronic
1029310277 7:99656931-99656953 AGATGCAATAAAAATGATAAAGG - Intronic
1029922439 7:104279815-104279837 AGATGCAATAAAAATGATAAAGG + Intergenic
1029951399 7:104589962-104589984 AGATGCAATAAAAATGATAAAGG - Intronic
1030501736 7:110367860-110367882 AGATGCAATAAAAATGATAAAGG - Intergenic
1030669336 7:112317950-112317972 TGTGGGAATTAAAATCAACAAGG - Intronic
1030702715 7:112659091-112659113 AGATGCAATAAAAATGATAAAGG - Intergenic
1031139220 7:117923226-117923248 AGACGCAATAAAAATGATAAAGG + Intergenic
1031517651 7:122721330-122721352 AGACGCAATAAAAATGATAAAGG + Intronic
1032413897 7:131721153-131721175 TGAGGCCATCACAATGATCCAGG + Intergenic
1032701553 7:134384207-134384229 GCAGGAAAGTAAAATGATCAGGG + Intergenic
1036086804 8:5621441-5621463 TGAAGAAAGTAAAATGATCAAGG + Intergenic
1036436099 8:8734989-8735011 AGAAACAATTAAAATTATCAGGG + Intergenic
1036841562 8:12126947-12126969 TGAGTCTACTAAAATAATCATGG + Intergenic
1037039617 8:14214941-14214963 TGCAGCAATTAAGATGATTAGGG + Intronic
1037077788 8:14742980-14743002 TGAGAAAATTTAAATGCTCATGG - Intronic
1037215077 8:16440189-16440211 TGAGGTGAGTAAAATGTTCAGGG + Intronic
1037619522 8:20551277-20551299 TGTGGCAATAAAAATAATTAGGG - Intergenic
1038776716 8:30538071-30538093 TGAAGCAATGGAAATGACCAAGG + Intronic
1039861661 8:41464576-41464598 TTACACATTTAAAATGATCACGG + Intergenic
1039921831 8:41898373-41898395 TTAAGCAATTAAAATGTGCAGGG - Intergenic
1040136952 8:43865579-43865601 AGATGCAATAAAAATGATAAAGG - Intergenic
1040369476 8:46754954-46754976 AGATGCAATAAAAATGATAAAGG - Intergenic
1042698520 8:71584893-71584915 AGACGCAATAAAAATGATAAAGG + Intronic
1044280628 8:90351427-90351449 TGAGGGAATAAAAATGCTGATGG - Intergenic
1045626756 8:104060420-104060442 AGACGCAATAAAAATGATAAAGG - Intronic
1045647302 8:104311854-104311876 AGACGCAATAAAAATGATAAAGG + Intergenic
1045754429 8:105525854-105525876 TAAAGCACTTAAAATTATCAAGG + Intronic
1046091989 8:109513858-109513880 GGAGGCAATTACCATGATCCAGG - Intronic
1046292830 8:112185166-112185188 AGACGCAATAAAAATGATAAAGG + Intergenic
1046422409 8:114003138-114003160 AGATGCAATAAAAATGATAAAGG - Intergenic
1047098341 8:121648491-121648513 TAAGGCCATTAAAATGTTAAAGG - Intergenic
1047443738 8:124901537-124901559 TGAAGCAGTTAAAATGATAAAGG - Intergenic
1048087883 8:131203779-131203801 TAAGGAAATTAACATGATGAGGG + Intergenic
1050010154 9:1177815-1177837 AGAGGCATTTAAAAAAATCAAGG + Intergenic
1050660573 9:7879182-7879204 TGAGGAAATTAAAATGATGTGGG - Intronic
1050954664 9:11639509-11639531 AGATGCAATAAAAATGATAAAGG - Intergenic
1051111849 9:13648547-13648569 GGAGGCAATTAAAATGATGATGG - Intergenic
1051514535 9:17913812-17913834 AGACGCAATAAAAATGATAATGG + Intergenic
1052154607 9:25169384-25169406 AGATGCAATAAAAATGATAAAGG + Intergenic
1052213214 9:25932145-25932167 AGATGCAATAAAAATGATAAAGG - Intergenic
1052214477 9:25950036-25950058 TGAAGTAATTAAAAGAATCAAGG - Intergenic
1053827363 9:42039378-42039400 AGATGCAATAAAAATGATAAAGG + Intronic
1054339607 9:63846716-63846738 AGATGCAATAAAAATGATAAAGG + Intergenic
1054603198 9:67148062-67148084 AGATGCAATAAAAATGATAAAGG - Intergenic
1055063731 9:72097755-72097777 AGATGCAATAAAAATGATAAAGG + Intergenic
1055304318 9:74913165-74913187 TAAGGCCATTATAATGATAAAGG + Intergenic
1055617367 9:78086890-78086912 AGATGCAATAAAAATGATAAAGG + Intergenic
1055866658 9:80822157-80822179 GTAAGCAATTAAAAGGATCATGG + Intergenic
1055939437 9:81635559-81635581 TGAGACAGTAAAAATGATTAAGG + Intronic
1056117599 9:83456249-83456271 TGCGGCCATTAAAAAGAACAAGG - Intronic
1056289413 9:85127617-85127639 TAAATCAAATAAAATGATCAAGG - Intergenic
1056952668 9:91056351-91056373 TGAGGCAATGAAGATGTTCATGG - Intergenic
1058330417 9:103753396-103753418 AGACGCAATAAAAATGATAAAGG + Intergenic
1059616744 9:115959683-115959705 AGATGCAATAAAAATGATAAAGG - Intergenic
1062619554 9:137413757-137413779 TGGGGCAATGAAAATGTTCTGGG - Intronic
1202630012 M:8747-8769 TGTGGCAATAAAAATGATTAAGG - Intergenic
1187476152 X:19612878-19612900 TGAGGCAATGAGAATGGTCAAGG + Intronic
1187585537 X:20657351-20657373 GGAGGCAATTGTAATGATCCTGG + Intergenic
1187643825 X:21324401-21324423 TAAAGCAAATAAAATTATCAGGG - Intergenic
1187755302 X:22518760-22518782 AGTAGCAACTAAAATGATCAGGG + Intergenic
1188540233 X:31241725-31241747 TGAGGTAATTGACATGATGAGGG - Intronic
1189562946 X:42209615-42209637 TGAGTCAACTGAAATGTTCAAGG + Intergenic
1189703041 X:43731537-43731559 TGAGGCAACAAAACAGATCAAGG - Intronic
1190601092 X:52093477-52093499 AGATGCAATAAAAATGATAAAGG - Intergenic
1191042945 X:56104565-56104587 AGATGCAATCAAAATGATAAAGG - Intergenic
1191168262 X:57415078-57415100 AGATGCAATAAAAATGATGAAGG - Intronic
1191177911 X:57525450-57525472 TTAGGGAATTAAAAAGATAAGGG - Intergenic
1191217491 X:57948678-57948700 AGATGCAATAAAAATGATAAAGG - Intergenic
1191948864 X:66566367-66566389 AGATGCAATAAAAATGATAAAGG + Intergenic
1191990448 X:67029460-67029482 AGATGCAATAAAAATGATAAAGG + Intergenic
1192010736 X:67269699-67269721 AGATGCAATAAAAATGATAAAGG + Intergenic
1192071527 X:67945811-67945833 AGACGCAATAAAAATGATAAAGG + Intergenic
1192204285 X:69085928-69085950 GCAGGCAATGAAAATGATTAAGG - Intergenic
1193895734 X:87112789-87112811 AGATGCAATAAAAATGATAAAGG + Intergenic
1194958761 X:100211648-100211670 AGATGCAATAAAAATGATAAAGG - Intergenic
1195556443 X:106230629-106230651 TGAGCCTATTGAGATGATCATGG - Intergenic
1197024180 X:121727661-121727683 TCAGGCAATTAAAATAATTAGGG + Intergenic
1197273880 X:124455314-124455336 TGGGGCAAGTTAAATGATGATGG + Intronic
1197420526 X:126232311-126232333 AGACGCAATAAAAATGATAAAGG - Intergenic
1197954520 X:131931701-131931723 TGAAGCAGTTAAAATGATACAGG - Intergenic
1198060272 X:133039012-133039034 AGATGCAATAAAAATGATAAAGG - Intronic
1198496685 X:137200348-137200370 TGAGGGAAATAGAAAGATCAAGG - Intergenic
1199135515 X:144245356-144245378 TGACGTATTTAAAATGATAAAGG + Intergenic
1199681433 X:150227337-150227359 TGAGGGACTTAAAATGAACTGGG + Intergenic
1199946897 X:152677335-152677357 GGACGCAATAAAAATGATAAAGG - Intergenic
1201182443 Y:11362080-11362102 AGATGCAATAAAAATGATAAAGG + Intergenic
1201522435 Y:14890409-14890431 AGACACAATAAAAATGATCAAGG - Intergenic
1201619807 Y:15943827-15943849 AGATGCAATAAAAATGATAAAGG - Intergenic
1201688517 Y:16734934-16734956 AGATGCAATAAAAATGATAAAGG - Intergenic
1201691051 Y:16765330-16765352 AGATGCAATAAAAATGATAAAGG + Intergenic
1201783600 Y:17749072-17749094 AGAAGCAATAAAAATGATAAAGG + Intergenic
1201817953 Y:18156915-18156937 AGAAGCAATAAAAATGATAAAGG - Intergenic
1202072682 Y:21008765-21008787 AGACGCAATAAAAATGATAAAGG - Intergenic
1202079194 Y:21066892-21066914 AGACGCAATAAAAATGATAAAGG + Intergenic
1202084926 Y:21126373-21126395 AGAAGCAATAAAAATGATAAAGG - Intergenic