ID: 1091162968

View in Genome Browser
Species Human (GRCh38)
Location 11:133442763-133442785
Sequence GTGTCTTTTTTGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 414}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091162968 Original CRISPR GTGTCTTTTTTGAGGGAAGA AGG Intronic
901509022 1:9705530-9705552 GTGTCTTTTTGGTGAGTAGAAGG - Intronic
902429329 1:16351221-16351243 GTCTCTTTCTTGAGGAATGATGG - Intronic
903848476 1:26292133-26292155 GACTCATTATTGAGGGAAGAGGG - Intronic
910241765 1:85094135-85094157 GTTTCTTTTTTGTGAGAAAAGGG - Intronic
911366570 1:96946006-96946028 GTGACTTGTTAGTGGGAAGAGGG + Intergenic
915029575 1:152866341-152866363 GAGTGTTTTTTGAGGCAGGAGGG + Intergenic
916494747 1:165336381-165336403 GTGTCTGTTTCTGGGGAAGAGGG - Intronic
916996464 1:170307082-170307104 GTGTTTTTTTTGGGGGGGGAGGG - Intergenic
917106210 1:171494778-171494800 GTTTCTTTCTTGAGGGAGGGGGG - Intronic
917697894 1:177546850-177546872 ATGGATTTTGTGAGGGAAGATGG - Intergenic
918174748 1:182033524-182033546 TTTACATTTTTGAGGGAAGAAGG + Intergenic
918412011 1:184269432-184269454 CTCTCTTATTTGAGAGAAGAGGG + Intergenic
918428272 1:184432840-184432862 CTGTCTTTATTGAAGGAAAAGGG + Intronic
918571379 1:185997172-185997194 GTGCCTTCATTGAGGGAATAAGG + Intronic
919076289 1:192817170-192817192 CTGTCTATTTGGAGTGAAGAGGG + Intergenic
919085621 1:192917480-192917502 GTGTCCTTCTTGAGGTATGATGG - Intergenic
919289329 1:195609351-195609373 ATCTCTTTTTTGAGCGGAGAGGG + Intergenic
919404106 1:197154670-197154692 TTGTTTGTTTTGAGGGTAGAGGG - Exonic
920016646 1:202916295-202916317 GTGACTGTTCTGAGGGAAAATGG - Intronic
920145017 1:203852646-203852668 GTCTCTTTTTTGTGGAGAGAAGG - Exonic
920328974 1:205191075-205191097 GTGACTTTTTGTAGGAAAGATGG - Intronic
920532977 1:206717997-206718019 GTTTTGTTTTTTAGGGAAGAGGG - Intronic
920737896 1:208551730-208551752 GTGCCATTTTAGAGGGGAGAGGG - Intergenic
921006295 1:211096507-211096529 CTGCCTGTTTTTAGGGAAGAGGG + Intronic
921820290 1:219609359-219609381 GTCTCTTTTTTGTGGAGAGAAGG + Intergenic
923076030 1:230609239-230609261 GTACCATCTTTGAGGGAAGAGGG + Intergenic
923276232 1:232399371-232399393 ATGTACTTTTTGAGGGGAGAAGG + Intronic
1063199771 10:3776518-3776540 TTGTTTTTTTTGGGGGAAGGGGG - Exonic
1063436410 10:6035655-6035677 GTGCCTTTTATGTGGGCAGAGGG + Intronic
1064076683 10:12274488-12274510 GTGTATTTTTTTAGTGGAGATGG + Intergenic
1064267166 10:13834401-13834423 GGGTTTTATTTTAGGGAAGACGG - Intronic
1064447845 10:15412267-15412289 TTTTGTATTTTGAGGGAAGAAGG + Intergenic
1064732447 10:18346582-18346604 GTGGCTTTTTTGGGGGAGGAGGG + Intronic
1065008068 10:21397691-21397713 GAGTCTTTTTGGAGAGTAGAGGG + Intergenic
1065235513 10:23647566-23647588 GGGTCTTTTCTTTGGGAAGAGGG - Intergenic
1065972828 10:30818654-30818676 GTGGCTGTTTTCAAGGAAGAGGG + Intergenic
1066359869 10:34719681-34719703 ATGTCCTTTTGGAGGGGAGAAGG - Intronic
1067723556 10:48749043-48749065 GTATCTACATTGAGGGAAGATGG + Intronic
1068050040 10:51938634-51938656 GTGTCTTCTCAGTGGGAAGAGGG - Intronic
1071337625 10:84613806-84613828 GTGTCTTTCTTGGGGGAACTGGG + Intergenic
1072947176 10:99820585-99820607 CTGTCTTTTTTGAGCAGAGATGG - Intronic
1073605224 10:104888038-104888060 GTGTTTTTTTTGAAGGCAGTTGG + Intronic
1073999314 10:109353251-109353273 GGGGCTTATTTGAGGGAGGAGGG - Intergenic
1074447141 10:113529931-113529953 GTGGCCTTTTTGAGAGAAGCAGG + Intergenic
1075174315 10:120145086-120145108 TTTTCTTTTTTGTGGGAACAGGG - Intergenic
1075492162 10:122880305-122880327 GTGGCTTGTTTGAGGGTAGATGG - Intergenic
1075498776 10:122953693-122953715 GTGTCTTGTTTGAGGGTAGAGGG + Intronic
1075913843 10:126149051-126149073 CTGTCTCTTTACAGGGAAGAGGG - Intronic
1075984197 10:126769122-126769144 GTTTTTTTTATGAGGGAGGAAGG - Intergenic
1076306535 10:129469124-129469146 CTGTCCTTTTGCAGGGAAGAAGG + Intronic
1077374829 11:2200611-2200633 GTGTCTGCTTTGTGGGAAGAGGG - Intergenic
1078109044 11:8377120-8377142 GTGTCTTGGTTGAAGGAAAATGG - Intergenic
1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG + Intronic
1078748515 11:14138170-14138192 ATGTCTTTCTTGAGAAAAGAGGG - Intronic
1079793743 11:24772303-24772325 GTGTGTTTATTGAGGCAAGAAGG - Intronic
1080897004 11:36455553-36455575 GTGCCCTTTTAGCGGGAAGAGGG - Intronic
1081171363 11:39873648-39873670 GTCTCTTTTTTGAGCTTAGAAGG + Intergenic
1081295794 11:41387551-41387573 GAGTATTTTTTGAGGAGAGATGG + Intronic
1082819215 11:57532654-57532676 GTTTCTTTTTTGCGGGGAGTGGG - Intergenic
1085608777 11:77927466-77927488 GTTTCCTTTTTTGGGGAAGATGG - Intronic
1086453202 11:86937242-86937264 CTGTCTTTTTTCTGGGGAGATGG - Intronic
1086519400 11:87652364-87652386 TTGTCTTTTGTGTGGGGAGAGGG - Intergenic
1086531170 11:87786885-87786907 GTGACTTGCTTCAGGGAAGAAGG + Intergenic
1087250128 11:95889505-95889527 ATGTCTTTTTTGGGGGGGGAGGG + Intronic
1087942275 11:104112859-104112881 GGGGCTTTTCTGAGGGTAGAGGG + Intronic
1088147541 11:106700319-106700341 CTGTCTTTTTTGGGGGTAGGGGG - Intronic
1088416531 11:109595403-109595425 GTTTGTTTTTTAAGGGAAGCAGG - Intergenic
1088590736 11:111400566-111400588 GTGTCTTGTTTTTGGGAATAAGG - Intronic
1089117427 11:116107279-116107301 CTGTCTTTATTGAGGGGCGAAGG - Intergenic
1090072621 11:123557349-123557371 GTGTCCATTTTGAGGGTAGCAGG + Intronic
1091162968 11:133442763-133442785 GTGTCTTTTTTGAGGGAAGAAGG + Intronic
1091784911 12:3237499-3237521 GTGTCCTTGGTGAGGGAGGAGGG - Intronic
1091864345 12:3818279-3818301 GTTTCTTTTGTGAAGGAAGAAGG - Intronic
1092073150 12:5649814-5649836 GTGTATTTTTTTAGTAAAGACGG + Intronic
1092983675 12:13823590-13823612 ATGTCATTTGTGAAGGAAGATGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094534248 12:31306961-31306983 GTATCTTACTTGAGGGGAGAAGG - Intronic
1095666827 12:44811977-44811999 GGGTTTTTTTGGGGGGAAGATGG - Intronic
1096162057 12:49387040-49387062 TTGTGTTTTTTTAGGGAATAAGG + Exonic
1096918368 12:55057665-55057687 GTGTCTGTTTTCATGGCAGATGG + Intergenic
1097229185 12:57498766-57498788 CAGGCATTTTTGAGGGAAGATGG + Intronic
1097636297 12:62126444-62126466 GTGTCTCTTTCCAGGGCAGAAGG + Intronic
1097910988 12:64969000-64969022 GTGTCTGCTTTGGGGGAGGATGG + Intergenic
1098553445 12:71791476-71791498 GTTTTTTATTGGAGGGAAGAAGG + Exonic
1098846827 12:75547472-75547494 CAGACTTTTTTGAGGCAAGAAGG + Intergenic
1099532494 12:83801453-83801475 GTGTCTAGTTAGAGGGAAGAAGG + Intergenic
1099612861 12:84897018-84897040 TTGTATTTTTTTAGGGGAGAGGG - Intronic
1101267375 12:103103272-103103294 ATGGCTGTTTTCAGGGAAGATGG - Intergenic
1101955771 12:109211421-109211443 TTGTATTTTTTTAGTGAAGATGG + Intronic
1102708180 12:114901111-114901133 CTGTCTTTTCTGAGGAATGAGGG - Intergenic
1103059891 12:117850093-117850115 TTATTATTTTTGAGGGAAGAAGG + Intronic
1103272000 12:119681192-119681214 GTGTGATTTTATAGGGAAGAGGG - Exonic
1103287357 12:119813668-119813690 ATGCCTTTTTTGGGGGAAGATGG - Intronic
1104496130 12:129241139-129241161 TTTTTTTTTTTGAGGTAAGAGGG - Intronic
1104620566 12:130308809-130308831 TTGTCCTTTCTGAAGGAAGAGGG + Intergenic
1104636418 12:130440375-130440397 GTGTCTGTGTTGGAGGAAGAAGG - Intronic
1104693675 12:130847172-130847194 GTGGCCTTTTGGAGGGTAGAGGG - Intergenic
1105056704 12:133107341-133107363 GGTTCTATTTTGAGGGAAGGGGG + Exonic
1106864015 13:33943747-33943769 GCTTCTTTTTTGAGGCCAGAAGG + Intronic
1107051370 13:36054106-36054128 ATGTCTTTTTTCAGGGTAAAGGG + Intronic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108055964 13:46485604-46485626 GTGTCTTATTTGGGAGATGATGG - Intergenic
1109157105 13:58924890-58924912 ATGTCCTCTTTGAGTGAAGATGG + Intergenic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1109903332 13:68803578-68803600 ATATATTTTTTGAGGGAGGATGG - Intergenic
1109928422 13:69179950-69179972 TTGTCTTTATTAAGGGAAGATGG - Intergenic
1110098027 13:71556078-71556100 TAGTCTTTTTGGTGGGAAGAAGG + Intronic
1110456675 13:75696946-75696968 GTTTCTTTTTTAAAGGAAGCTGG + Intronic
1110576052 13:77056065-77056087 GTGTCTTATTTGTGGCAACAAGG - Intronic
1110676075 13:78246423-78246445 GGGTCTTTTAAGAGGGTAGAAGG + Intergenic
1111062373 13:83039088-83039110 GTGTCTTCTTCCAGGGCAGAGGG - Intergenic
1111447442 13:88366253-88366275 GTGTTTGTTTTAAGAGAAGATGG - Intergenic
1111454109 13:88456780-88456802 GTATCTTTTTTTAGCAAAGATGG - Intergenic
1111989336 13:95101205-95101227 GTGTTTTGTTTGTGGGAGGAGGG + Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1113239193 13:108317247-108317269 GTGACTTTTCTGCAGGAAGAGGG + Intergenic
1113322346 13:109246368-109246390 GTGTCTTGTCTGAGTGAAGGGGG + Intergenic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1115166544 14:30454405-30454427 CTGTCTTTTTTGTGGGGAGCAGG - Intergenic
1115465853 14:33713399-33713421 TTTGCTTTTTTGAGGGAGGAGGG + Intronic
1115466846 14:33724459-33724481 TTGTGTTTTTTGAGGAAACAGGG - Intronic
1115988970 14:39131944-39131966 GAATTTTTTTTTAGGGAAGATGG + Exonic
1116621663 14:47211622-47211644 GTGTCTGCCTTTAGGGAAGAGGG - Intronic
1117343485 14:54811019-54811041 GAGTCTGTTTTGGGGGAAAAGGG + Intergenic
1118620330 14:67609176-67609198 GTGTCTTTTTGCAGGGCAGCAGG + Intergenic
1119189496 14:72670814-72670836 GTCTCTTTTCTGAGGGGAGGGGG - Exonic
1119690863 14:76671410-76671432 GAGTCTTTTTTGTGGTAAGTGGG + Intergenic
1119725851 14:76921412-76921434 GTGTCTTTTTGCAGGGAAGAAGG - Intergenic
1120373970 14:83676476-83676498 GTGTACTTTTTGGAGGAAGAAGG - Intergenic
1120795333 14:88626060-88626082 GTCTCTACTTCGAGGGAAGAAGG - Exonic
1121484418 14:94303745-94303767 TTGTCTTTTATTAGGGAAGAGGG + Intergenic
1122315382 14:100823250-100823272 ATGGCCTTTTTGAGGGAGGAAGG + Intergenic
1125104951 15:35959881-35959903 GTGTATATTTTGAGAGAAAATGG + Intergenic
1126009042 15:44285182-44285204 TTTTTTTTTTTGAGGGGAGATGG - Intergenic
1126020027 15:44391103-44391125 CAGTCTCTTTTGAGGGAAGGGGG - Intronic
1126420166 15:48464187-48464209 GTGTGCCTTTTGAGGAAAGAGGG + Intronic
1126452556 15:48825177-48825199 TTGTCTTTTTAGCAGGAAGAGGG + Exonic
1126453303 15:48833964-48833986 GTGTTTCTTTTGGGGGAACAAGG + Intronic
1126674362 15:51146693-51146715 GAATCATTTTTGAGGGCAGAAGG + Intergenic
1128442931 15:67730222-67730244 GTGCTTTTTTTGAGGGCATAAGG - Intronic
1128612494 15:69085143-69085165 GGATCATTTTTCAGGGAAGAAGG - Intergenic
1129798256 15:78394421-78394443 GGATGTTTTTTGAGGGAAGAGGG - Intergenic
1129837212 15:78717039-78717061 GTGTGTTTTTTAAAGGAACAAGG + Intronic
1129865843 15:78907955-78907977 GTCTCTATTTTGGGGGTAGAGGG + Intergenic
1131742315 15:95406656-95406678 TTTTCTTTTTTGTGGGGAGAAGG + Intergenic
1133266728 16:4589271-4589293 ATGTCTTTTATGATGGAAGGTGG - Intronic
1133313247 16:4865121-4865143 GTGTCTCTTTTTAGGGGTGAGGG + Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1136143532 16:28302105-28302127 GGGACATTTTTCAGGGAAGAAGG + Intronic
1137282101 16:46986099-46986121 GTTTCTTTTTTGGGGGAATGGGG + Intergenic
1137688103 16:50400937-50400959 GTTTCTTCTTTGAGGGAGGCAGG - Intergenic
1138401751 16:56751108-56751130 GTGTCTTTGGTGAGAAAAGAGGG - Intronic
1139228854 16:65261620-65261642 ATTTCATTTTTGAGGGAGGATGG + Intergenic
1139457208 16:67090479-67090501 ATGTCTTTTGTGAAGGAAGATGG + Intronic
1140647728 16:77051316-77051338 GTTTCTTTTCTGAGGCAATAAGG + Intergenic
1141051232 16:80766121-80766143 GTGTTTTTTTTGAAGGAGAAGGG + Intronic
1141183097 16:81767875-81767897 GTGTCTTTTTTGGGGGGAGTCGG + Intronic
1141523545 16:84597187-84597209 GAGTCTTTCTTGAGGAGAGATGG + Intronic
1142756673 17:2020504-2020526 GCTTCTCTTTTGTGGGAAGAAGG - Intronic
1143618121 17:8065447-8065469 GTGGCTTCTGTGTGGGAAGAAGG + Intergenic
1144304713 17:13957808-13957830 TTTTCTTTTTTCAGGGATGAGGG + Intergenic
1145266575 17:21382663-21382685 CTGTCTTTTCTGAGGCAACATGG - Intronic
1146155432 17:30520044-30520066 GTCTGTGTTTTGAGGGTAGAGGG + Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1147950468 17:44104878-44104900 GTGTCTGCTTTGTGGGAAGAGGG - Intronic
1148501322 17:48093717-48093739 GTAGATTTTGTGAGGGAAGAAGG - Intronic
1149458340 17:56807635-56807657 GTTTGTGTTTAGAGGGAAGAAGG - Intronic
1150491432 17:65577047-65577069 CGCTCTTTTGTGAGGGAAGATGG - Intronic
1150657320 17:67048084-67048106 GTGACTTTTTTGAACTAAGATGG - Intronic
1151174285 17:72274374-72274396 GTGTCCTTTGTGTGGGAGGATGG + Intergenic
1151219507 17:72602022-72602044 GTCTCTTTTTTGTGGGGAGATGG + Intergenic
1151257823 17:72893103-72893125 TTTTCTTTTTGGAGGGAAGTTGG - Intronic
1152088115 17:78232377-78232399 CTGTCAGTTTTGGGGGAAGACGG - Intronic
1152183864 17:78841761-78841783 GTGTCTTTTTTGATGTAAGTAGG + Intergenic
1153235505 18:2982787-2982809 ATGTCTTTTTTCAGAGATGAAGG + Intronic
1153450563 18:5223283-5223305 GTGGCTTTTTTGGGGGGAGGGGG - Intergenic
1155721158 18:29013357-29013379 TTATCTTATTTGGGGGAAGAGGG - Intergenic
1155821171 18:30379686-30379708 ATGTCTTTTTTGGGGGAAGTTGG - Intergenic
1156361372 18:36387176-36387198 GTGTCCTGCTTGAGGGGAGATGG + Intronic
1157135129 18:45046542-45046564 GTGTATTTATTCAGAGAAGAAGG + Intronic
1157783559 18:50461823-50461845 GTGTCTTTTCTGGGTGAAGAAGG - Intergenic
1158332403 18:56376842-56376864 TTGTCTCTTTTCAGGGTAGAAGG + Intergenic
1159213108 18:65354899-65354921 ATGTCTTTTTTGAGTCAGGATGG + Intergenic
1163092279 19:15028865-15028887 ATTTATTTTTTGATGGAAGAAGG + Intergenic
1163204054 19:15789402-15789424 GTGTCTCCTTTGAGGAGAGAGGG + Intergenic
1163318761 19:16559445-16559467 GTGTATTTTTTGTAGAAAGAAGG - Intronic
1163961671 19:20702044-20702066 GTCTCTTTTTAGAAGAAAGATGG + Intronic
1165488932 19:36112199-36112221 TTGTTTTTTTTGAGGGGGGATGG - Intronic
1167159721 19:47759362-47759384 GTGTCTTTTGTCAGGAAGGAAGG + Intergenic
1168134925 19:54344423-54344445 TTCTTTTTTTTGAGGGAACAAGG + Intergenic
1168271527 19:55252570-55252592 GTGTGTTTTTTTAGTAAAGACGG + Intronic
925063120 2:908754-908776 GTGTCTTCTGGAAGGGAAGAGGG + Intergenic
925757312 2:7146231-7146253 CATTCTTTTTTGAGGGGAGATGG + Intergenic
927738268 2:25542521-25542543 GTTTCATTTTTGAGGCTAGAGGG - Intronic
928821786 2:35370328-35370350 GTGTCTGTTTTGCGTGAAGATGG - Intergenic
928924192 2:36560391-36560413 ATGTCATTTTTGGGGGAAGAAGG - Intronic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
929617097 2:43319879-43319901 TTTTCTTTTTTAAGGGAAAATGG - Intronic
930168074 2:48222818-48222840 CTGTCTGTTTTGTGGGAAGGTGG - Intergenic
930399026 2:50859532-50859554 AAGTCTTTTTTGAGGGGAAAAGG + Intronic
931286817 2:60839293-60839315 GTGTCCTTTTTTAGAAAAGAAGG - Intergenic
933860723 2:86464481-86464503 GTGTCTTCTTTTAAGGAAAAGGG + Intronic
933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG + Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937179415 2:119976908-119976930 TTGTCTTTTTTGGGGGGAGAGGG + Intronic
937427050 2:121808831-121808853 GTATCTTTGTGGAGTGAAGAAGG + Intergenic
937825467 2:126364302-126364324 GTGCCTTTTCTCAGGGGAGATGG + Intergenic
938135793 2:128755420-128755442 GTGTATTTTTGGAGAGAAAAAGG - Intergenic
938203502 2:129397443-129397465 ATGGCTTTCTTGAAGGAAGAGGG + Intergenic
938211495 2:129469303-129469325 GTGTTTCTTTTGTGGGGAGAAGG + Intergenic
938644776 2:133319260-133319282 ATCTCATTTTTGAGGGTAGAGGG + Intronic
939359622 2:141152452-141152474 TTGTCATTTGTTAGGGAAGAAGG - Intronic
939839918 2:147174342-147174364 TTGGCTTTTTTGAGGGAAAGTGG - Intergenic
941580516 2:167292361-167292383 GCGTTTATTTGGAGGGAAGACGG + Intergenic
941680306 2:168391121-168391143 GTGTTTTCTTTGAAGAAAGAAGG + Intergenic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943016875 2:182523245-182523267 GTGTGTTTTTTGAAGGAAAAGGG + Intergenic
943442611 2:187944613-187944635 GTGTGTTTTTTTAGTGAAGATGG + Intergenic
943598019 2:189880254-189880276 GTGGTTTTTTTGAGGGCAGGAGG + Intronic
943767887 2:191681505-191681527 GTGTCTTTTATGGAGGCAGAAGG + Intronic
943857365 2:192814664-192814686 GTTTCTTTTTTGACAGAACACGG + Intergenic
944907669 2:204278918-204278940 AGGTCTTTTTTGAGGGTGGAGGG - Intergenic
945650513 2:212552896-212552918 GTGTCTTTTATGAGAAATGAAGG - Intergenic
947489682 2:230582846-230582868 GTGTTTTTTGGGAGGGAAGGAGG - Intergenic
947746316 2:232509058-232509080 GTTTCTTTCTGGAGGGCAGAGGG - Intergenic
948002321 2:234578346-234578368 GTGTGTGTTTTGGGGGAGGAGGG - Intergenic
948112924 2:235471478-235471500 CTCTCTGTTTTGAGGCAAGATGG + Intergenic
948589430 2:239039706-239039728 GATTCTCTTTTGAGGGCAGAAGG + Intergenic
1171295466 20:24012947-24012969 GTGTCTTTACAGAGAGAAGAGGG - Intergenic
1172265023 20:33604036-33604058 GTGGCATTTTTGATGGAAGCTGG - Intronic
1172427017 20:34862432-34862454 GTGTATTTTTGGAGGACAGAGGG + Intronic
1172591865 20:36123266-36123288 GGGTCTAGTTTGGGGGAAGAGGG + Intronic
1173084610 20:39903920-39903942 GTTTCTTTTTTGAGAGGACATGG + Intergenic
1174067070 20:47873302-47873324 GTGTCCCCTTTGAGGGAAGCAGG + Intergenic
1174253952 20:49240311-49240333 GGGTCTTTTTTAAAGGGAGATGG - Intronic
1175114253 20:56670948-56670970 AAGTCATTTTTCAGGGAAGATGG - Intergenic
1175277947 20:57784565-57784587 GTGTGTTTTTTGCGGGGAGGGGG + Intergenic
1175614162 20:60378527-60378549 GTTTCTTTTTTTATGGAAGAGGG - Intergenic
1176968285 21:15236380-15236402 GTGGCTTGTTTTAGGGGAGAAGG + Intergenic
1177101938 21:16908754-16908776 GCCTCTTCTTTGACGGAAGAGGG + Intergenic
1177314454 21:19438721-19438743 TTGTGATTTTTGAGGGGAGAGGG - Intergenic
1177983853 21:27948628-27948650 GTGTGTTGTGTGAGGGAGGAGGG - Intergenic
1178243241 21:30926302-30926324 ATGGCTTTATTGGGGGAAGAAGG - Intergenic
1178812465 21:35896535-35896557 GAGTGTTTTTTGAGAGAGGAGGG - Intronic
1178943082 21:36923704-36923726 GTTTTATTTTTGTGGGAAGAAGG - Intronic
1179206527 21:39285748-39285770 GTGTGTTTTTTGAGTAGAGATGG - Intronic
1180645708 22:17337162-17337184 GCTTCTATTCTGAGGGAAGAAGG - Intergenic
1181054459 22:20253588-20253610 GTCACTTTTATGAGGGAAGCTGG - Intronic
1182294471 22:29305102-29305124 GTGTCTCTTTTGAGGGACATGGG - Intergenic
1182420965 22:30248371-30248393 GTCTCTTCTTTGAGGGACCATGG + Intergenic
1182791619 22:32957807-32957829 GAGTCTCTATTGAGGGAAAAGGG - Intronic
1182825860 22:33264185-33264207 GTGTCTTGTTTAAGGCCAGAGGG + Intronic
1182841227 22:33391649-33391671 TTTTCTTTTTTGGGAGAAGAGGG - Intronic
1182906075 22:33937614-33937636 GTGTCATTTTTGTGGGGACAAGG + Intergenic
1184026968 22:41865130-41865152 GTGTGTTTTTTGGGGGATGTGGG - Intronic
1185408973 22:50672933-50672955 GAGGCTGTTTTGAGGGGAGAGGG + Intergenic
950292360 3:11795607-11795629 GGGTTTCTTTTGAGGGCAGAGGG - Intronic
950580685 3:13860057-13860079 GTTTTTTTTTTTAAGGAAGATGG + Intronic
951622243 3:24615762-24615784 GATTTTGTTTTGAGGGAAGATGG - Intergenic
952849543 3:37716191-37716213 GTGTGTCTTTTGTGGGAGGATGG - Intronic
953591216 3:44256680-44256702 TTGTTTTGTTTGAGGGAAGGGGG + Intronic
954459734 3:50619491-50619513 GTGGCTCTTCTGAGGGCAGACGG + Intronic
954565261 3:51594604-51594626 GTTTCTGCTTTGAGGGAAGAAGG + Intronic
955104593 3:55885068-55885090 GTGTGATGTTAGAGGGAAGAGGG - Intronic
955156820 3:56425199-56425221 GTGTGTGTTTTGTGGGGAGATGG - Intronic
955711857 3:61787929-61787951 GTGTCTTTTTTTCTTGAAGATGG + Intronic
956181827 3:66524545-66524567 GTGTCTTTATCGAGAGAATAAGG + Intergenic
956203657 3:66733673-66733695 TTTTCTTTTTTGACTGAAGAAGG - Intergenic
956927323 3:74003428-74003450 GTGTCTTTTTTGTGGGAAAGGGG - Intergenic
957639701 3:82836198-82836220 GTGTGTTTTTTGAAGGCTGAGGG + Intergenic
958838588 3:99174578-99174600 GTGTCTGTTGTGGGGGGAGAGGG - Intergenic
958931393 3:100211750-100211772 TTGACTTTATTGATGGAAGAAGG - Intergenic
959275231 3:104269656-104269678 GTGGCTGCTGTGAGGGAAGAAGG + Intergenic
959276068 3:104278748-104278770 TTGTTTTTTTTGGGGGGAGAGGG - Intergenic
959557639 3:107740240-107740262 GTGTCTTTTATGAGAAGAGATGG - Intronic
960447861 3:117769705-117769727 GTATCTCTTTTAAGGGATGATGG - Intergenic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
960616086 3:119597397-119597419 GTGTCCATTTAAAGGGAAGAAGG - Intergenic
960849262 3:122035435-122035457 GTGTCTTTTTTTTGGGGAAAAGG - Intergenic
961094638 3:124143962-124143984 GTGTCTCTTTTGGGGCCAGAGGG + Intronic
961105909 3:124241149-124241171 GTGTTATTTTTGGGGGAAGTAGG - Intronic
962629141 3:137258386-137258408 TTTTCTTTTTGAAGGGAAGATGG + Intergenic
962734620 3:138314789-138314811 TTTTCTTTTGTGAGGGAAAATGG + Intronic
963272961 3:143303376-143303398 TTTTTTTTTTTGAGGGAAGGAGG + Intronic
963648056 3:147942659-147942681 TTGTTTTGTTTGAGGGAGGATGG + Intergenic
963770472 3:149381410-149381432 GTTTCTTTTTTCTGGGGAGAGGG - Intergenic
963801029 3:149676449-149676471 GTGTTTTTTTTGCGGAAAGAAGG + Intronic
964537401 3:157738880-157738902 ATGTCTTTTATGAGGGAAGTTGG - Intergenic
964572784 3:158128423-158128445 GTGTCTTTCTTGGGGGAATGAGG + Intronic
965739916 3:171863454-171863476 GTGTCTTTTTTAATGAAAGGGGG + Intronic
965780702 3:172282899-172282921 GTGTCTTTGTTGACTGAGGAAGG - Intronic
966110135 3:176391088-176391110 GTATGTTTTTTGAGGAGAGATGG + Intergenic
966188409 3:177248578-177248600 GTGTCTTTTCCAAGGAAAGATGG - Intergenic
967057983 3:185846836-185846858 ATGTCTTTTCTGAGAGAAGGAGG + Intergenic
967301845 3:188021927-188021949 GTGTGTTTTGTGTGGGAAGTTGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967503431 3:190225953-190225975 ATTTTTTCTTTGAGGGAAGAAGG - Intergenic
968264651 3:197353625-197353647 GTGGCTATTTTGTGGGGAGAGGG + Intergenic
969400552 4:6952681-6952703 TTTTCTTTTTTAAGGGATGATGG + Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
970619000 4:17797724-17797746 GGGTCTTTTTTGATGGAAGATGG + Intergenic
971498413 4:27292414-27292436 ATGTCTCCTCTGAGGGAAGATGG + Intergenic
971874976 4:32296886-32296908 TTGTATTTTTTTAGGAAAGATGG - Intergenic
971881103 4:32373959-32373981 ATTTTTTTTTTGAGGAAAGAAGG + Intergenic
972399898 4:38691081-38691103 AGGTTTTTTTTGAGGTAAGAGGG - Intronic
973050978 4:45596050-45596072 GGGGCTTTTTTGAGGGTCGAGGG - Intergenic
974482149 4:62459089-62459111 TTGTCTTTTTTGGTAGAAGACGG - Intergenic
974514241 4:62887793-62887815 GGGGCTTACTTGAGGGAAGAAGG + Intergenic
974523872 4:63022060-63022082 GTGGCTGTTTTGGGGGCAGATGG + Intergenic
974542310 4:63252939-63252961 GTATTTTTTTAGGGGGAAGATGG + Intergenic
974755124 4:66195456-66195478 GTTTCTATTATCAGGGAAGAAGG - Intergenic
975341657 4:73249275-73249297 CTTTCTTTTGTGGGGGAAGATGG + Intronic
975947932 4:79730470-79730492 GTGTGATGTTTGAGGGCAGAGGG - Intergenic
976566139 4:86552722-86552744 GTGTCTCTTTTTAGAGCAGAGGG + Intronic
976793413 4:88905908-88905930 GTTTGTTTTTTCAGGGAAGTAGG - Intronic
976869224 4:89770179-89770201 GTCTTTTATTTAAGGGAAGAAGG + Intronic
976928826 4:90536765-90536787 GTTTCTTTTTTGATGGAATGAGG + Intronic
977726434 4:100302094-100302116 TGTTCTTTTTTGGGGGAAGAGGG - Intergenic
978215198 4:106192569-106192591 GTTTCAATTTTGAGGGAAGGGGG + Intronic
978760519 4:112352328-112352350 GTGGATTTTTTGAGGGGAGCAGG - Intronic
978963314 4:114710548-114710570 GTTTTTTCTTTCAGGGAAGAGGG + Intergenic
979381020 4:120006864-120006886 GGGTCTTTTGTGAAGGAAGGAGG + Intergenic
981072649 4:140560459-140560481 TTTCCTTTTTTGAGGGAAGGGGG + Intronic
981312552 4:143311388-143311410 GTGTCTATTTTAAAGGAATAAGG + Intergenic
982048082 4:151469095-151469117 TCAGCTTTTTTGAGGGAAGAGGG - Intronic
982220273 4:153118638-153118660 TTGTATTTTTTTAGAGAAGAGGG + Intergenic
983813926 4:172098990-172099012 GTGTGTTTATTGAGGGAATTTGG + Intronic
985096823 4:186421058-186421080 GTGTCTTTTTTGCTTCAAGAAGG - Intergenic
985798718 5:1986353-1986375 ATGTCTTTTTTGGGGGGACAGGG - Intergenic
986010881 5:3714189-3714211 GTATCTTTTCTCAGGGGAGAAGG - Intergenic
986450497 5:7858707-7858729 GTGTATTTTTTGAAGGAGGGAGG - Intronic
986674508 5:10171252-10171274 GTGTCTTGGGTGAGGGAAGGAGG + Intergenic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
989044527 5:37261676-37261698 GTGTCCTTTTTGAACAAAGATGG + Intergenic
989824814 5:45840288-45840310 TTGTCTTTTTGGGAGGAAGATGG + Intergenic
990863974 5:60359830-60359852 GTGTGTTTTGTGGGGGTAGATGG - Intronic
990875887 5:60485186-60485208 GTGCTTTTTCTGTGGGAAGAGGG + Intronic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
991416351 5:66396783-66396805 GTGTCTTTGTGGCGGGACGAAGG + Intergenic
991951271 5:71948697-71948719 GTTTTTTTTGGGAGGGAAGAGGG + Intergenic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
992533169 5:77671693-77671715 GTCGCTTTTGTCAGGGAAGAGGG + Intergenic
992612386 5:78518804-78518826 GTGTCCTCTTTCTGGGAAGAGGG + Intronic
992697652 5:79306128-79306150 TTCTCTTTTTTGAAGGAGGAGGG - Intronic
993493134 5:88576642-88576664 GTGTCTTTTTTAAGCTAAAAGGG + Intergenic
993691977 5:91013029-91013051 GTGTTTTTCTTGTGGGAACAAGG - Intronic
995567770 5:113449612-113449634 ACTTCTTTTTTGAGGGAAGTAGG + Intronic
995655656 5:114423334-114423356 GTGTCTTTTTTGGGGGCTGTGGG - Intronic
997978214 5:138452813-138452835 TTTTTTTTTTTGAGAGAAGATGG + Intergenic
998296797 5:140978396-140978418 GTCTCTTTTCTGATTGAAGAGGG - Intronic
1000015134 5:157269118-157269140 TTTGCTTTTTTGAGGGAAGTTGG + Intronic
1000149748 5:158487943-158487965 TTGCCTCTTTTCAGGGAAGAAGG - Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000915097 5:167071956-167071978 GTGCCTTTGTGGAGGGTAGAAGG + Intergenic
1001222893 5:169917912-169917934 GTGTCTCATTTCAGGGCAGAGGG + Intronic
1002042746 5:176526661-176526683 GTGTCTTTTTGGTGGGAGGTGGG - Intergenic
1003547035 6:7067862-7067884 TTATTTTTTTTGAGGCAAGAAGG + Intergenic
1004291006 6:14367288-14367310 TTGTTTTCTTTGAGGGAAGAGGG - Intergenic
1004355001 6:14923062-14923084 GGGTCTTGTTTGGGGCAAGAAGG - Intergenic
1004475351 6:15966374-15966396 CTGTCTTTTTTCAGGGAAACTGG - Intergenic
1005393613 6:25359061-25359083 GTGTCTTTTTTCTGCCAAGATGG + Intronic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1006426778 6:33968326-33968348 GTTGCTATTTTGAGTGAAGATGG - Intergenic
1008302117 6:49854082-49854104 TTCTCTTTACTGAGGGAAGAAGG - Intronic
1008538085 6:52522693-52522715 GTGTCATTTTTGATGGGAGGTGG - Intronic
1009565347 6:65305203-65305225 GTCTCTTTTTTGTGGAGAGAAGG - Intronic
1011372638 6:86654263-86654285 GTGTATCTTTTCAGGGAAGGTGG - Intergenic
1011491592 6:87898898-87898920 GTCTCTTTTTTTAGGGGGGAGGG + Intergenic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1012599382 6:101075821-101075843 GAGTTTTTATTGATGGAAGATGG - Intergenic
1012998568 6:105997633-105997655 ATGCCTTTTTTAAGGGAAGTAGG + Intergenic
1013199231 6:107876036-107876058 GTGTTTTTTTTCTAGGAAGAAGG - Intronic
1014056920 6:117026511-117026533 GTGTTTTTGTTTGGGGAAGAGGG + Intergenic
1016407168 6:143742721-143742743 GTGTCTTTTTGGGGGGAAGGAGG - Intronic
1016547050 6:145235943-145235965 GTGTCTATTTCAAAGGAAGATGG + Intergenic
1017599404 6:156064277-156064299 GTGTTTTTTTTGGGGGGAGGGGG - Intergenic
1018373825 6:163192753-163192775 GTGTGTATTTGCAGGGAAGATGG + Intronic
1020415501 7:7941241-7941263 GTTTGTTTTTTGAGAGGAGAGGG - Intronic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1021311697 7:19105671-19105693 GTGTCTTTTGAGAGAGAGGAGGG + Intronic
1022073361 7:26939985-26940007 GTGTCCTTTTACAAGGAAGAAGG - Intronic
1022419763 7:30209480-30209502 GTGTCTTTTCCGAGGGAGGAAGG - Intergenic
1022534341 7:31086487-31086509 GTATCTCCTTTCAGGGAAGAAGG - Exonic
1022800115 7:33768931-33768953 GTGTGTTTTTTAAGGGAGAATGG - Intergenic
1023359986 7:39406066-39406088 CTTTCTTGTTTGAGGGGAGAAGG - Intronic
1024544899 7:50508924-50508946 CTTTCTTGTTGGAGGGAAGAGGG - Intronic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1025780329 7:64595729-64595751 TTGTTTTTTTTGGGGGAAGTGGG - Intergenic
1026479663 7:70766571-70766593 ATGACTGTTTTGAGGGCAGATGG - Intronic
1028490880 7:91410264-91410286 TTGTTTCTTTTGAGGGCAGAAGG - Intergenic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1028893357 7:96013327-96013349 GTTTCTTTTTGGAGGGTAAAGGG - Intronic
1029920488 7:104257258-104257280 GTGCATTTTTTGTGGGCAGAGGG + Intergenic
1029936977 7:104435586-104435608 GTGTGTTTCTTGAGTGAGGAAGG - Intronic
1030352696 7:108507479-108507501 TTGTATTTTTTGTGGAAAGAGGG - Intronic
1030723448 7:112897554-112897576 GTATGTTTTTTGAGGGTATATGG - Intronic
1031729850 7:125286296-125286318 TTATCTTTTTTGAGGGAAATAGG + Intergenic
1031829236 7:126606103-126606125 GTTTGTTTTTTGAGTGCAGAGGG + Intronic
1033261658 7:139849361-139849383 GTGTTTTTTTTGGGGGAACAGGG - Intronic
1033500993 7:141949404-141949426 GTGTGTTTTGTGGGGGAAAATGG + Intronic
1033652483 7:143353363-143353385 GTGTCTTATTTGGGGGATGGAGG - Intergenic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1034465439 7:151225772-151225794 GTAAGTTTTTGGAGGGAAGACGG + Intronic
1036374513 8:8188842-8188864 GTGTTTGTCTTGAGGGAAGGCGG - Intergenic
1036577904 8:10045437-10045459 GTGTCTTTCAGGAGGGAAGCGGG + Intergenic
1036855029 8:12234305-12234327 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1036876390 8:12476793-12476815 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1037416824 8:18660174-18660196 GTGTCTTTATAGAAGGCAGACGG + Intronic
1038306458 8:26407496-26407518 GTGTTTTTTTTTAGTAAAGACGG + Intronic
1038349591 8:26763775-26763797 TTGTTTTGTTTGAGAGAAGAAGG + Intronic
1038660784 8:29494912-29494934 GTGTCTTTTCCCAGGAAAGAAGG + Intergenic
1039054711 8:33526463-33526485 ACTTCTTTTTTGAGGGGAGAGGG - Intergenic
1039208505 8:35184376-35184398 TAGTTTTTTTTGAGTGAAGAGGG - Intergenic
1039377663 8:37052459-37052481 GTGTCCTTTTTCTGGGAAGAGGG - Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1040575696 8:48649335-48649357 GTGTTTTTTTACAGGGAACAAGG + Intergenic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1042147624 8:65747298-65747320 GTTTCTTTATTGATGGAATACGG + Intronic
1042153175 8:65811725-65811747 GTGTGTAGTTAGAGGGAAGAAGG + Intronic
1045833299 8:106490534-106490556 GTGCATATTTTTAGGGAAGATGG + Intronic
1046639989 8:116718912-116718934 TTTTCTTTTTTGGGGGAAGCAGG - Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046816653 8:118591882-118591904 GGGTATTTTGGGAGGGAAGAAGG + Intronic
1047015303 8:120717863-120717885 GGCTCTTTTTTGAGGAAAGAGGG - Intronic
1047238549 8:123064075-123064097 GTTTCTTTTTTGTGGGAAATAGG - Intronic
1047676200 8:127205845-127205867 TTTTCTCTTTTGAGGGAAGCAGG - Intergenic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1050051483 9:1606839-1606861 GTTTCTTCTGTGAGGAAAGATGG + Intergenic
1050841847 9:10159147-10159169 TTGCCTTTTTTGAGAGTAGATGG - Intronic
1050858450 9:10392569-10392591 GTGTATTATTTGAAGGAATAAGG - Intronic
1051915224 9:22199765-22199787 GTGTGTTTTTGGAGGTAAAAAGG + Intergenic
1052250583 9:26392982-26393004 TTGTCATTTTTGAGAGAAGAGGG - Intergenic
1052488611 9:29133932-29133954 GTGTCTTTAGTGAGGGAAGGAGG - Intergenic
1052904628 9:33822809-33822831 TTGTTTTTTTAGGGGGAAGAGGG - Intronic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1055092942 9:72381097-72381119 GTGTTTGTTTTGAGGGAAGGTGG + Intergenic
1055538602 9:77276993-77277015 GTATCTTTGTTGGGGGCAGAGGG + Intronic
1055727324 9:79245002-79245024 AAGTCTTTTTTAAGGAAAGAAGG - Intergenic
1056198892 9:84255624-84255646 TTTGCTTTTTTGAGGTAAGAGGG - Intergenic
1056697539 9:88872505-88872527 TTTTATTTTTTGAGGGAAGGGGG + Intergenic
1057330283 9:94107754-94107776 GTTTCTATTTTGAGAGAAGGAGG - Intronic
1057419924 9:94903151-94903173 TTGTCTTTTTTGTGGAGAGACGG + Intronic
1058996500 9:110304131-110304153 GCATCTTTTTTGAAGAAAGATGG + Intronic
1059458895 9:114417196-114417218 GTGTCTGCTTTGAGGGGAAATGG + Intronic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1189103701 X:38216041-38216063 GTGTCCTTTTTCTGGGGAGACGG - Intronic
1190842605 X:54159558-54159580 GTGGCGTTTTTCAGGGAAAATGG - Exonic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1193552329 X:82911270-82911292 GTGTGTCTTTTGAGGAAAGAAGG - Intergenic
1193694369 X:84689692-84689714 GATTGTTTTTTGAGGGAATAGGG - Intergenic
1193923124 X:87453945-87453967 CTTTCCTTTTTGAGGGGAGATGG - Intergenic
1195090625 X:101455047-101455069 ATGGATTTTTTGAGGGAAGGAGG + Intronic
1196628778 X:117910728-117910750 ATGTCTTTCTTAAGGGCAGAGGG + Intronic
1199211647 X:145218925-145218947 GTATGTTTTTTGAGGGAGGAAGG - Intergenic
1199217695 X:145279860-145279882 GTGTGTTTTTTGTGGGAAACGGG + Intergenic
1200240907 X:154493085-154493107 GTGTCCTTCTTGAAGGAAAAGGG + Intergenic