ID: 1091163632

View in Genome Browser
Species Human (GRCh38)
Location 11:133450086-133450108
Sequence CTTTTGTTCTTATGGTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091163632 Original CRISPR CTTTTGTTCTTATGGTCACA AGG (reversed) Intronic
901176437 1:7302780-7302802 CTTTTCTTTTGTTGGTCACATGG + Intronic
901213958 1:7543439-7543461 CTTTTATTATTATTTTCACATGG + Intronic
901873780 1:12154273-12154295 CTTTTGTTGTTGTTGTTACAAGG - Intergenic
902335097 1:15749938-15749960 CTTTCCTTTTTATGGGCACAGGG + Intergenic
903272219 1:22196790-22196812 CTTTTGTGATTATGGGCACAAGG + Intergenic
905177071 1:36143519-36143541 CTTTTGTTTTAAAAGTCACAAGG - Intronic
906001005 1:42424887-42424909 CTTCTTTTCTTAAGGTCAGATGG + Intergenic
907400584 1:54222555-54222577 CTTTTCTTCTCGTGGTCACCAGG + Intronic
907611827 1:55878923-55878945 CTTTTTGTCTTCTGATCACAGGG + Intergenic
908132521 1:61088390-61088412 ATTTTGTTCTTACAGTTACAGGG + Exonic
908225760 1:62054354-62054376 CTTTTTTTTTTTTGGACACAGGG - Intronic
908329541 1:63057234-63057256 CTTTTGTAATTGTGGTTACATGG - Intergenic
908957053 1:69644873-69644895 CATTTATTTTGATGGTCACAAGG - Intronic
912677977 1:111703595-111703617 ATTTTTTTCTTTTGGTCACAGGG - Intronic
913431130 1:118791767-118791789 ATATTTTTCTTATTGTCACATGG + Intergenic
913968338 1:143394998-143395020 CTTGTGTTCTCAGGGTCCCACGG + Intergenic
914062716 1:144220594-144220616 CTTGTGTTCTCAGGGTCCCACGG + Intergenic
914116434 1:144745760-144745782 CTTGTGTTCTCAGGGTCCCACGG - Intergenic
916082888 1:161247012-161247034 TTTTTTTTCTTATTGTCACTCGG + Intergenic
916662190 1:166932984-166933006 CTTCTGTACTCATGGTCCCATGG - Intronic
918387655 1:184026377-184026399 CTTGTGCTCTTTTGGTGACAGGG - Intronic
919427585 1:197451775-197451797 CTTTTCTTCTTAATGTCATATGG + Intronic
921450303 1:215297507-215297529 CTTTTGACCTTATTGTAACAAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921831253 1:219730334-219730356 GTGGTGTACTTATGGTCACAGGG - Intronic
922159314 1:223066941-223066963 ATTTTCTTCTTATTTTCACAAGG + Intergenic
924103246 1:240625365-240625387 CTCTTGGTCTCATGGTCTCATGG - Intergenic
1063049505 10:2431360-2431382 CTTTTGTTCTTTTATTAACATGG + Intergenic
1063410076 10:5830765-5830787 CTTCTTTTCTTGTGGTCACCTGG + Intronic
1063995612 10:11615697-11615719 CTTTTTTTCATATGCTCAAAGGG + Intergenic
1065453890 10:25886102-25886124 CTTTTATTCTTATTATCTCAAGG + Intergenic
1065904449 10:30237753-30237775 CTTTAGTTTTTATTTTCACAAGG + Intergenic
1065937864 10:30536827-30536849 CTTTTGTTTGTTAGGTCACATGG - Intergenic
1068786673 10:60983421-60983443 CTTTTGTTCTCATCTTAACATGG - Intronic
1071317192 10:84413588-84413610 CATTTCTTCTCATGGCCACAGGG - Intronic
1071396517 10:85228975-85228997 CTCTTGGTCCCATGGTCACAGGG + Intergenic
1072810250 10:98456010-98456032 CTTGTGTTTTTATCGTCAGAGGG + Intergenic
1073804579 10:107083540-107083562 CTTTTTTTCTTATCTTTACAAGG + Intronic
1074059907 10:109955593-109955615 CTATTGTTCAGATGGTCTCAAGG - Intergenic
1074872551 10:117588453-117588475 CATTAGGTCTTGTGGTCACAGGG - Intergenic
1075034939 10:119057196-119057218 TTTTTTTCCTTATGGTCAAATGG - Intronic
1075965488 10:126608113-126608135 CTTGTATTCTTTTGGACACAGGG + Intronic
1076343049 10:129762848-129762870 GTTTTTTTCTTCTGGTCAAATGG - Intronic
1076487992 10:130836465-130836487 CTTTTCTTCTTATGGCCACGTGG + Intergenic
1078040593 11:7858932-7858954 CTATTGTTCCTATGTCCACAGGG + Intergenic
1078393906 11:10961785-10961807 CTTTTGTATTTATGTTCACAAGG - Intergenic
1080850087 11:36060737-36060759 CCTTTGTTGTTTTGGTCACAAGG + Intronic
1081026574 11:38021848-38021870 ATATTGTTCTCATGGCCACATGG + Intergenic
1081695026 11:45103629-45103651 CTTCTGTCTTGATGGTCACACGG + Intronic
1082073096 11:47955320-47955342 CTTTTATGCTTATGGGCCCAGGG - Intergenic
1082787635 11:57325499-57325521 CTTTTGTTCTTACGGGAAGAAGG - Intergenic
1082808837 11:57466461-57466483 CTTTTTTTCTTTTGGAGACAGGG - Intronic
1086782784 11:90928926-90928948 CTTTCGTTCTTTTGGGCAAAAGG + Intergenic
1087837128 11:102886446-102886468 CTTTTCTTCTTTTTGACACAGGG - Intergenic
1089279830 11:117366063-117366085 ATTTAGTTCTTTTTGTCACATGG + Intronic
1091163632 11:133450086-133450108 CTTTTGTTCTTATGGTCACAAGG - Intronic
1092081508 12:5720273-5720295 CTTTTGATATGATGGTCAAAAGG - Intronic
1092661027 12:10738598-10738620 CTATGGTTCCTATGGTCACCTGG + Intergenic
1093273256 12:17092647-17092669 CTTTTATTCTTATGAACAAAAGG - Intergenic
1096439258 12:51625626-51625648 CTTTTGTTTTTTTGGACAGAGGG + Intronic
1097403683 12:59161855-59161877 TTTTTTTTATTATTGTCACATGG + Intergenic
1100910132 12:99350557-99350579 CTTTTGTTTTTATTTTCATATGG - Intronic
1101072691 12:101093030-101093052 ATTTTGTTTTTATGATCAAATGG + Intronic
1101287138 12:103326472-103326494 GATTTATTTTTATGGTCACAAGG + Intronic
1101688819 12:107054831-107054853 CTTTTGTTCTTATCATTACGAGG - Intronic
1102141157 12:110616256-110616278 TTTTTTTTTTTTTGGTCACAGGG + Intronic
1102733446 12:115135809-115135831 CTTTTGTGCTGATGGTGACCTGG - Intergenic
1104542547 12:129680781-129680803 CCTCTGTTCTTAGGGTCAGAAGG + Intronic
1105978478 13:25494629-25494651 CTGTTGTTCTGATATTCACAGGG + Intronic
1106289595 13:28348314-28348336 CTTTTATCCTGATGGTGACAGGG - Intronic
1108941931 13:55966061-55966083 CTTTTGTGTGTATGGTCAAATGG + Intergenic
1109321822 13:60819229-60819251 ATGTTGTTCTTTGGGTCACAAGG + Intergenic
1109851339 13:68068508-68068530 CTTTTCTTCTCAAGTTCACATGG - Intergenic
1111093707 13:83481275-83481297 CTTTTGTACTTGAGGTGACAGGG - Intergenic
1111717931 13:91904203-91904225 GTTTTATACTCATGGTCACATGG + Intronic
1111860264 13:93695871-93695893 TTTTTGTTCTTATAGTTAGAAGG + Intronic
1112412337 13:99175338-99175360 CTTGGGTTTTTTTGGTCACATGG - Intergenic
1112803601 13:103138342-103138364 CTTCTGTTCTTGAAGTCACAAGG - Intergenic
1112919163 13:104588956-104588978 CCTTTGTTCTTATGGTTTTATGG + Intergenic
1115374501 14:32659403-32659425 TATTTGTGCTTATGGTCACAAGG - Intronic
1116644300 14:47506938-47506960 TTTCTGTTTTTATGGTCACTAGG + Intronic
1116689769 14:48090611-48090633 CTTTTGTTCTTTCGGTTAAAAGG - Intergenic
1119617536 14:76108583-76108605 CTTCAGTTCTTGTGCTCACAGGG - Intergenic
1120139221 14:80909412-80909434 CTTTTTTTCTTTTGGTGGCAGGG - Intronic
1121003536 14:90470811-90470833 TTTTTTTTCTTTTGGACACAGGG + Intergenic
1121997733 14:98616837-98616859 CTTGTGGTTTTGTGGTCACATGG + Intergenic
1127663032 15:61118331-61118353 CTTTTGTGCTTTAGTTCACAGGG - Intronic
1128265290 15:66260777-66260799 CTTGTGTTCTAGTGGGCACAGGG - Intergenic
1132625700 16:890482-890504 CTGATGTCCTGATGGTCACACGG - Intronic
1133156728 16:3880977-3880999 CTTTTGTTCTGATGGCGACCAGG + Intergenic
1134300476 16:12986245-12986267 CTTTTTTTCCTTTGGACACAGGG + Intronic
1136033792 16:27522948-27522970 CTTTTTTTTTTAGAGTCACAGGG + Intronic
1136688860 16:32013527-32013549 CTTTTGTTTCTATAGTCACAAGG - Intergenic
1136789454 16:32957038-32957060 CTTTTGTTTCTATAGTCACAAGG - Intergenic
1136880358 16:33896892-33896914 CTTTTGTTTCTATAGTCACAAGG + Intergenic
1138486485 16:57348254-57348276 GTTTTTTTCTTCTCGTCACAAGG - Intergenic
1140178112 16:72685367-72685389 CTTTTTTTTTTTTGGCCACAGGG + Intergenic
1141027881 16:80564992-80565014 CCTCTGCTCTTAGGGTCACACGG + Intergenic
1141183547 16:81771140-81771162 GTTTTGATCTTGTGGTCACATGG - Intronic
1141738484 16:85872672-85872694 CTTTTGTGTTTATGTTTACAGGG + Intergenic
1141751929 16:85964233-85964255 TTTTTTTTCTTATGTTCACGAGG + Intergenic
1203091654 16_KI270728v1_random:1218512-1218534 CTTTTGTTTCTATAGTCACAAGG - Intergenic
1143348683 17:6270548-6270570 CTTTTTTTCTTATTTTCATAAGG - Intergenic
1143529245 17:7492144-7492166 CTTTTGTTATTGTGGCCTCAGGG + Intronic
1144242972 17:13332065-13332087 CTTTTTTCCTTATGTTCAGAGGG + Intergenic
1144387491 17:14762923-14762945 ATTTTGTTCTTATCGGAACAGGG + Intergenic
1145881555 17:28356552-28356574 TTTTTGTTCATATTCTCACAGGG + Intronic
1146456327 17:33012531-33012553 CTTTTGGTGTTACGGACACAGGG - Intergenic
1146784655 17:35708553-35708575 TTTTTGTTCTTATAGTCATCAGG + Intronic
1147151710 17:38519688-38519710 CTTTTGTTTCTATAGTCACAAGG - Intergenic
1148182754 17:45618836-45618858 CTTTCATTCTTATTGTCCCATGG + Intergenic
1148266105 17:46226867-46226889 CTTTCATTCTTATTGTCCCATGG - Intergenic
1149335684 17:55633336-55633358 CTTTTGTTCTTCAGGTCCTAAGG - Intergenic
1149603732 17:57910300-57910322 TTTTTCTTTTTATTGTCACAGGG - Intronic
1149729259 17:58928223-58928245 CTTTTTTTCTTTTGGAAACAGGG - Intronic
1151524238 17:74652966-74652988 CCTTTGCTCTTTTGGTCACCTGG + Intergenic
1151851385 17:76692204-76692226 TTTTTTTTCTTTTGGTGACAGGG - Intronic
1155523874 18:26697122-26697144 CTATTACTCTTATGGTCACTAGG - Intergenic
1155601785 18:27557307-27557329 CTTTTGTTATTATGGATAAAGGG + Intergenic
1155621090 18:27780941-27780963 CATTAGTTGTTATGGTCACCAGG + Intergenic
1156793185 18:41003761-41003783 CTTTTTTTCTTCTGTTTACATGG - Intergenic
1159194885 18:65100640-65100662 CTGTTATTCTTTAGGTCACATGG - Intergenic
1159504051 18:69311270-69311292 CTTTTTTTTTTCTGGTGACAGGG - Intergenic
1162831509 19:13287342-13287364 TTTTTGTTTTTTTGGTGACAGGG - Intronic
1163812042 19:19439177-19439199 CATTTATTCTTATGGGCACAGGG + Intronic
1165166117 19:33858061-33858083 CTTTTGTTGTTGTTGTTACATGG - Intergenic
1165210959 19:34235357-34235379 CTTTTTTTCTTTTGGAGACAGGG - Intergenic
1167051643 19:47082696-47082718 CTTTTGTCCTCATGGTTACACGG - Intronic
1168048649 19:53812062-53812084 CTTTTGTTTTTATAGAGACAGGG - Intronic
1202702125 1_KI270712v1_random:172466-172488 CTTGTGTTCTCAGGGTCCCACGG + Intergenic
926844435 2:17120105-17120127 CTATTGTTCTTATGGTAAACTGG - Intergenic
927406113 2:22769590-22769612 CTTTTTTACTGATGTTCACATGG - Intergenic
929251723 2:39764635-39764657 CTTCTGTTGTTAGGGTCACCAGG + Intronic
929453710 2:42052150-42052172 CTTTTGGGGTTACGGTCACAGGG - Intronic
929751760 2:44722256-44722278 CTTGGGTTTATATGGTCACATGG + Intronic
929909943 2:46081326-46081348 TTTTTGTTCTTCTATTCACATGG + Intronic
930770700 2:55127916-55127938 CTTTTTTTTTTTTGGACACAGGG + Intergenic
930780996 2:55224739-55224761 CTGATGTTCTCATGGACACAAGG - Intronic
934173038 2:89555912-89555934 CTTGTGTTCTCAGGGTCCCACGG + Intergenic
934283352 2:91630269-91630291 CTTGTGTTCTCAGGGTCCCACGG + Intergenic
935408323 2:102733209-102733231 ATTTTGTTCTTATTCTCACTAGG + Intronic
936167836 2:110139423-110139445 CTCTTTTTCTTATGTTGACAAGG + Intronic
937784714 2:125883142-125883164 CTTTTTTTCTTATGATAACTTGG + Intergenic
938230593 2:129655292-129655314 CCATTGTTCCTGTGGTCACAAGG - Intergenic
938789355 2:134663100-134663122 TTTTTGTTCTTCTGGCCACAGGG - Intronic
940294755 2:152110916-152110938 CTTTCTTTCTCATAGTCACATGG + Intergenic
940430176 2:153580337-153580359 CTTTTTTTTTTTTGGTCAAATGG - Intergenic
940831830 2:158475110-158475132 TTTTTGTTCTTGTTGTCACCAGG + Intronic
941045166 2:160666658-160666680 CTTTTCTTCCTTTGGTCAAAAGG - Intergenic
943482882 2:188443467-188443489 TTTTTTTTCTTATGGTGAAATGG - Intronic
944490310 2:200251908-200251930 ATTTTGTTCTTAAAGTCAGAAGG - Intergenic
946553946 2:220833833-220833855 TTTTAGTTCTTCTAGTCACAGGG - Intergenic
946673438 2:222131183-222131205 TTTTTGTTGTTGTTGTCACATGG + Intergenic
947209492 2:227695043-227695065 CTTTTGTTCTTTTTGAGACAGGG - Intronic
947696723 2:232196557-232196579 CTTTTAATCCTATGGTCACTGGG - Intronic
948097498 2:235347926-235347948 CTTTTGATTTTATGGTTAAATGG - Intergenic
1170703035 20:18721308-18721330 CATTTGTTCATGTGGCCACATGG + Intronic
1170748514 20:19122784-19122806 CTTTTTTCATTATGGTCACAAGG - Intergenic
1171253614 20:23669105-23669127 CTTTTGTTCTTGTGGTTAACAGG + Intergenic
1171441189 20:25164553-25164575 CCTTTTCTCTTGTGGTCACAAGG + Intergenic
1172248292 20:33461157-33461179 CTTTTTTTTTTTTGGACACAGGG - Intergenic
1173093128 20:39995054-39995076 CTTTTGTGTTTATGCACACATGG + Intergenic
1173950841 20:46992173-46992195 TGTTTGTTCTGATGGTGACAGGG - Intronic
1175569980 20:60011035-60011057 TTCTTGTTCTTCTGGTCACCCGG - Intronic
1176894325 21:14358532-14358554 CTTTAGTTCTCATGGTCATAGGG + Intergenic
1177249184 21:18570150-18570172 CTTTTGTTCTTCTAGCCATAGGG - Intergenic
1179574007 21:42295560-42295582 CTTTGGATCTTAGTGTCACATGG - Intronic
1182070589 22:27460963-27460985 CTTTTGTTCCTGAGGTCGCAGGG + Intergenic
1183046868 22:35227443-35227465 CACTGGTTCTTGTGGTCACAGGG - Intergenic
1183286974 22:36972772-36972794 CCTTATTTCTTATGGTCACAGGG - Intergenic
1183347830 22:37317758-37317780 CTACTATTATTATGGTCACAAGG + Intergenic
949810203 3:7999480-7999502 CGTTTGCTCTTAGGCTCACATGG - Intergenic
950585454 3:13889172-13889194 CATTTTTGCTTATGGTCATAAGG + Intergenic
951053835 3:18124602-18124624 CTTTCTTTCTTTTGGGCACATGG + Intronic
951079502 3:18435549-18435571 CTTTTTTGCTTTTGGTCACCTGG - Intronic
952109741 3:30108912-30108934 CTTGGGTTTTTATGGTTACAGGG - Intergenic
952944381 3:38467743-38467765 CTTTTTTTTTTTTGGACACAGGG - Intronic
954167829 3:48774753-48774775 CTTTCTTTTTTATGGTCAAATGG + Intronic
955096562 3:55804593-55804615 CAGTTCTTCTTAGGGTCACAAGG - Intronic
955376664 3:58402760-58402782 TTTTTTTTTTTTTGGTCACATGG + Intronic
955377158 3:58407565-58407587 CTTTTTTTCTTTTGGAGACAGGG + Intronic
956442712 3:69295821-69295843 CTTTTTTTCTTTTGGAGACAGGG + Intronic
959651864 3:108758035-108758057 CTTGTCTCCTCATGGTCACAAGG + Intergenic
960275104 3:115720173-115720195 TTTTTGTCTTCATGGTCACAAGG + Intronic
960458596 3:117904317-117904339 CTTTTGTTGTCATGTTAACATGG + Intergenic
961853360 3:129844121-129844143 CGTTTTTTGTTATGATCACATGG - Intronic
962448660 3:135492806-135492828 CTTTTCTTCCTGTGGTCTCAGGG + Intergenic
962670069 3:137695772-137695794 CTATGGGTCTTATGTTCACATGG - Intergenic
962784526 3:138754433-138754455 TTTTTGTTTTTTTGGTGACAAGG - Intronic
963140360 3:141941792-141941814 CTTTTGTTCTTGTAGCCACATGG - Intergenic
963485124 3:145926058-145926080 CTATTGTTCTTATTATCACATGG - Intergenic
965004925 3:163008242-163008264 CTTTTTTTCTTATTGAGACAGGG - Intergenic
965882350 3:173400989-173401011 CCTTTCTTCTCATGGGCACAAGG + Intronic
966981588 3:185140960-185140982 CTTTTTTTTTTTTGGTGACAAGG - Intronic
967037558 3:185659215-185659237 TTTTTTTTCTTATGGAGACAGGG - Intronic
967804157 3:193699739-193699761 CTTGAGTTCTCATTGTCACAAGG - Intergenic
967805406 3:193711127-193711149 CTTTTCTTCTTCTTGTCAAAGGG - Intergenic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
970083058 4:12311273-12311295 TTTTTGTGCTTATATTCACAGGG + Intergenic
974120618 4:57633639-57633661 CTTTTCTTCTAAAGGTCAGATGG + Intergenic
974602380 4:64101016-64101038 CTTTTGATCTTTTTTTCACACGG + Intergenic
974615585 4:64275219-64275241 CTTTTATTCTTTGGGTTACATGG - Intergenic
974883368 4:67786429-67786451 CTTTTTTTCTTTTGGAGACAGGG - Intergenic
976717550 4:88138842-88138864 CATTTTTTTTTATGGTCAAATGG - Intronic
976863223 4:89691263-89691285 CTTTTTTTCTTTTCGCCACAAGG + Intergenic
978142011 4:105328776-105328798 CTTTTGTTCTTTTTGGCAAATGG + Intergenic
980500781 4:133650045-133650067 TTTTTGTTTTTATCTTCACATGG + Intergenic
981113859 4:140967280-140967302 TTTTTTTTCTTCTGTTCACAAGG + Intronic
981717483 4:147765791-147765813 CTTTTGTTTTTATCGAGACAGGG - Intronic
983392401 4:167149105-167149127 ATATTGCTCTTGTGGTCACATGG - Intronic
983540726 4:168906860-168906882 CTTTTTTTCCTATGTTAACAAGG - Intronic
983558797 4:169081360-169081382 CTTTTTTTCCTTTGGTAACAGGG - Intergenic
984637561 4:182128116-182128138 TTTTTGTTGTTTTGGTCAAAAGG + Intergenic
986157566 5:5191577-5191599 ATTTAGTTCTTATGTTCATATGG - Intronic
986562113 5:9070723-9070745 CTTATGTTCTTATTTTCTCATGG + Intronic
987013120 5:13788095-13788117 CTTTTGTGATTATGGTTCCAGGG - Intronic
987940941 5:24535616-24535638 GTTTTGTTCTTATTCTCCCATGG + Intronic
988364295 5:30276052-30276074 CTCTTGTTCCTATGCTCACTAGG + Intergenic
989259696 5:39405207-39405229 CTTTTGGTCTTTTGATCACGTGG + Intronic
990790597 5:59474416-59474438 CTTTCCTTTTTCTGGTCACATGG + Intronic
991923563 5:71681613-71681635 TTTTTGTTACTATGGACACATGG + Intergenic
992208519 5:74454503-74454525 GTTATTTTGTTATGGTCACAAGG - Intergenic
992734285 5:79703381-79703403 TTTTTGTTCTTATTGTAAAATGG - Intronic
992805716 5:80335603-80335625 CATTTTTTCTTTTGGTGACATGG - Intergenic
993351024 5:86850750-86850772 CTTTTATTCTTATTGTGCCATGG + Intergenic
993715938 5:91275983-91276005 CCTTTGCTCCTGTGGTCACATGG - Intergenic
995698878 5:114910767-114910789 TTGTTGTTCTTATGTTCTCAAGG - Intergenic
996156507 5:120109274-120109296 CATTTGTACTGATGGTCACAAGG + Intergenic
997044635 5:130299628-130299650 CTTTTCTTCTTCTGGTTACCTGG - Intergenic
997211492 5:132079626-132079648 CTTGAGTTCTGATGGACACAAGG - Intergenic
1000436910 5:161223037-161223059 CTTTTGTTTTTATGTTCATCAGG - Intergenic
1003804506 6:9711892-9711914 CTTTTTTTATTATGATTACATGG - Intronic
1004307727 6:14516028-14516050 GATTTGTTCTTATGGTCTCGGGG - Intergenic
1004357064 6:14939115-14939137 CTTATGTTCATATGGACTCATGG + Intergenic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1005041749 6:21606644-21606666 CTTTTGTTCCTAGGGTCTCATGG + Intergenic
1007108736 6:39300775-39300797 CTTTTGTACTTATGGCCTCTCGG + Intronic
1008796055 6:55304466-55304488 TTTGTCTTATTATGGTCACATGG + Intergenic
1010982364 6:82382458-82382480 CTTCTTTCCTTATAGTCACACGG - Intergenic
1011121166 6:83954588-83954610 TTTATGTTCTTATGTACACAGGG + Intronic
1012482448 6:99682105-99682127 CTCTTTGTCTCATGGTCACAAGG - Intergenic
1013757449 6:113478244-113478266 CTTTTATTCTTATTGTGACTTGG - Intergenic
1014071695 6:117189011-117189033 CTTTTTCTCTGATGGCCACATGG - Intergenic
1014217867 6:118769922-118769944 ATTTTCTTCTAATAGTCACATGG + Intergenic
1014933922 6:127364729-127364751 CTTTTATTGTGATGGTGACAGGG + Intergenic
1017303513 6:152889974-152889996 TTTTTGTTCTTATGGCCAAGAGG + Intergenic
1017569988 6:155733760-155733782 CTTTTGTGCTCATGGATACAAGG - Intergenic
1018355354 6:163009140-163009162 ATTTTGTTGTTGTTGTCACATGG - Intronic
1018830610 6:167440063-167440085 TTTTTTTTCTTATGTTAACATGG - Intergenic
1020933450 7:14429534-14429556 CTTTAGTTCTGGTAGTCACATGG + Intronic
1021010363 7:15456332-15456354 CTTTTGTTGTTATTGTCACTTGG + Intronic
1022025005 7:26440189-26440211 CTTTTGTGCTGATCATCACAGGG + Intergenic
1023169621 7:37378023-37378045 CTTTTCTTCTTAGGGTTGCATGG - Intronic
1023438202 7:40160000-40160022 CTTATGTTCTTTTGCTCTCATGG - Intronic
1024147149 7:46529248-46529270 CTTTTGTTCTTAAGGTATCAGGG - Intergenic
1024234471 7:47387531-47387553 CCTTTGTCCTTATGGGGACAGGG - Intronic
1026367320 7:69661658-69661680 CTTTTGTTGTTTTGGTCTCATGG + Intronic
1027623444 7:80520736-80520758 CTTGTGTCCCTAAGGTCACAAGG - Intronic
1027996319 7:85429306-85429328 CTTTTATTATTATTTTCACATGG + Intergenic
1028299949 7:89185870-89185892 CTTTTTTTCTTATTGAGACAGGG - Intronic
1029863978 7:103605583-103605605 CTGTGGTTCTTTTGGTCAAAGGG + Intronic
1030295168 7:107917903-107917925 CTTTTTTTCTGACTGTCACAGGG + Exonic
1030904521 7:115165397-115165419 CTTTTGTTTCTATGGTCATCAGG + Intergenic
1030999889 7:116402678-116402700 AATTTGTTCCTATGTTCACATGG + Intronic
1032556333 7:132839242-132839264 TTGTTGTTCTTGTGGTCACGTGG - Intronic
1033291165 7:140084044-140084066 CTTTGGTCCTTCTGGTCACTTGG + Intergenic
1035191639 7:157174452-157174474 CTTTTGTTTTTTTGGAGACAGGG + Intronic
1036148485 8:6276254-6276276 CTTTTTTTTTTTTTGTCACAGGG + Intergenic
1037360964 8:18073224-18073246 CTTTTATTCTTATGGGGAAATGG - Intronic
1041042104 8:53857476-53857498 TTTTTGTTCTTAATATCACATGG - Intronic
1041231922 8:55761326-55761348 CCTTTGTGCTTCTGCTCACATGG + Intronic
1041797885 8:61765350-61765372 CTTTTGTTTTCCTGGCCACAAGG - Intergenic
1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG + Intergenic
1045798644 8:106076568-106076590 CCTCTGTTCTTATGGTGAGAAGG + Intergenic
1046291548 8:112168510-112168532 CTTTTTCTATTCTGGTCACATGG - Intergenic
1048935475 8:139351912-139351934 CTTTTAGTCTTATGATCCCATGG + Intergenic
1049995873 9:1033057-1033079 TTTTTGTTTTTGTGGACACAGGG - Intergenic
1050001718 9:1084363-1084385 TTTTTTTTTTTTTGGTCACAGGG - Intergenic
1051840437 9:21391543-21391565 CTTTTGTTCATTTTGTTACATGG + Intergenic
1052308413 9:27037725-27037747 ATTTTGTTCTTAAGGACCCAGGG - Intronic
1052543136 9:29836791-29836813 CTCTTGTTCTTATGGGTACTTGG - Intergenic
1053455889 9:38232951-38232973 CTTTTGTTCTTGTGTACACTCGG - Intergenic
1054813170 9:69450980-69451002 CTTTTGGACTTCTGGCCACAAGG + Intronic
1056157606 9:83854570-83854592 CTTTTTTTATTTTGGACACAGGG + Intronic
1057136859 9:92696853-92696875 TTTCTGTTCTTATGTACACATGG - Intergenic
1058076852 9:100660232-100660254 CTTTATTTCTTACCGTCACATGG + Intergenic
1058255467 9:102756833-102756855 CATTTGTTCCTAGGGTCTCAGGG + Intergenic
1058820277 9:108723134-108723156 TTTTTCTCCTTATGGACACAGGG + Intergenic
1059223365 9:112647161-112647183 CTTTTTTTTTTTTGGTCCCATGG - Intronic
1059515077 9:114886407-114886429 CTTTTGTTCACTTTGTCACAGGG + Intergenic
1059916447 9:119107841-119107863 CTTTTGCATTTATGTTCACAAGG - Intergenic
1060944225 9:127560462-127560484 CCTTTGTCCTTAGGGTCCCAGGG - Intronic
1062316817 9:135971505-135971527 CTGTTGTTGTTCTTGTCACAGGG - Intergenic
1185752293 X:2622489-2622511 CTTTTGTTCTTTTCATCAGAAGG + Intergenic
1186741629 X:12524146-12524168 CTTTTGTTATTATCGTGACAGGG - Intronic
1187546164 X:20254638-20254660 CTTTTGTTCTAATGCTGATAGGG - Intronic
1188858832 X:35231622-35231644 CTTTTCTTCTTATGTTCAAAGGG - Intergenic
1189021345 X:37344904-37344926 CTTTTGTTCTTTTTTTCACAAGG + Intergenic
1189255800 X:39638072-39638094 CTCTTGTACTTATGGGCACGTGG - Intergenic
1190223838 X:48530609-48530631 CTTTTGTTTTTTTGGAGACAGGG + Intergenic
1193489223 X:82127512-82127534 CTTTTTTTCTCATTGGCACATGG + Intergenic
1193495837 X:82211522-82211544 TTTTTTTTATTGTGGTCACAGGG + Intergenic
1194208389 X:91039186-91039208 GTTTTGTTCTTTTGGTGGCAAGG + Intergenic
1194291812 X:92082434-92082456 TTTTTGCTCTTGTTGTCACAAGG + Intronic
1195351351 X:103999483-103999505 CCTTTGTTGTTATGCTCACAGGG + Intergenic
1196014024 X:110918299-110918321 CTTTTGTTTTTTTCCTCACAAGG - Intergenic
1196104256 X:111879372-111879394 GTTTATTTGTTATGGTCACAGGG + Intronic
1196645032 X:118108986-118109008 TTTTTGTTCTTATAGAGACAGGG + Intronic
1197609036 X:128617643-128617665 CTTTTTTTCTTATTGCTACAAGG + Intergenic
1199085422 X:143623414-143623436 CTGTTGTTCTTATGTCTACAAGG - Exonic
1199286589 X:146061104-146061126 CTTTTTATCTTTTGGTCACCAGG - Intergenic
1199818628 X:151422874-151422896 TTTTTGTTTTTTTGGTGACAGGG - Intergenic
1200609328 Y:5307006-5307028 GTTTTGCTCTTGTTGTCACAAGG + Intronic