ID: 1091165243

View in Genome Browser
Species Human (GRCh38)
Location 11:133469781-133469803
Sequence AGGTTTTTATAGATCCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091165237_1091165243 1 Left 1091165237 11:133469757-133469779 CCGACTATTTTATGAAAAACCCC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1091165243 11:133469781-133469803 AGGTTTTTATAGATCCTACCTGG 0: 1
1: 0
2: 0
3: 7
4: 77
1091165236_1091165243 4 Left 1091165236 11:133469754-133469776 CCTCCGACTATTTTATGAAAAAC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1091165243 11:133469781-133469803 AGGTTTTTATAGATCCTACCTGG 0: 1
1: 0
2: 0
3: 7
4: 77
1091165235_1091165243 15 Left 1091165235 11:133469743-133469765 CCTCAAGTGCTCCTCCGACTATT 0: 1
1: 0
2: 0
3: 11
4: 365
Right 1091165243 11:133469781-133469803 AGGTTTTTATAGATCCTACCTGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091165243 Original CRISPR AGGTTTTTATAGATCCTACC TGG Intronic
901330803 1:8406794-8406816 AGGTTTTTTAAGATCCTCACTGG - Intronic
903555478 1:24189874-24189896 AGGTTTTGAAAGATCCAACTTGG - Intergenic
905805598 1:40874762-40874784 ATGTTTTTATATATGCTACATGG + Intergenic
906013969 1:42556402-42556424 ATGTGTTTATAGCACCTACCTGG - Exonic
906382759 1:45343208-45343230 AGGGCTTTATTGAACCTACCGGG + Exonic
910203649 1:84725608-84725630 AGGTATCTATAGAGCCTACTAGG - Intergenic
916069579 1:161161991-161162013 AAGTTCCTATATATCCTACCTGG - Intronic
916142905 1:161714737-161714759 AGGTTATTATAGAGCCTGCCAGG - Intergenic
916756332 1:167773740-167773762 AGGGTTTTATATTTCCTAACTGG - Intronic
924188924 1:241527900-241527922 TTATTTTTATAGATCCTAGCAGG - Intergenic
1066135852 10:32445852-32445874 AGGTTCTCAAAGGTCCTACCAGG + Intergenic
1070116636 10:73535027-73535049 AGGGTTTTATAAAACCTATCGGG + Intronic
1070892017 10:79948122-79948144 AGGTGTTTCTAGAGACTACCAGG - Intronic
1072769878 10:98128856-98128878 TGGCATTTATAGATCCTATCTGG + Intergenic
1073637430 10:105214195-105214217 ACGTTATTATTGATCCTACCTGG - Intronic
1075185672 10:120254641-120254663 AGGTTTTTTTAAATCCTTCATGG - Intergenic
1087710255 11:101540910-101540932 AGGGTTTTATAGTTCCTTGCAGG - Intronic
1090364927 11:126197888-126197910 ATGTTTTTGTATATCCTACCAGG + Intergenic
1091165243 11:133469781-133469803 AGGTTTTTATAGATCCTACCTGG + Intronic
1093189707 12:16059969-16059991 ATGTTTTAATACATCCTACCTGG - Intergenic
1096859355 12:54512696-54512718 AGGTTTTTCTAGATCCTGAGAGG - Intronic
1099082496 12:78203253-78203275 AGGTTTTTAAAGAACCATCCAGG - Intronic
1102738506 12:115185157-115185179 TGGTTTTTATAGTTTCCACCTGG + Intergenic
1103636375 12:122309989-122310011 CTGTTATTATAGATCCTATCAGG - Intronic
1106139405 13:26999048-26999070 AGGTTTTAATAAATGCTTCCAGG - Intergenic
1108973087 13:56401830-56401852 TGGTATCTATAGATCCTGCCAGG + Intergenic
1109606221 13:64701179-64701201 AGGTGTTTTTGCATCCTACCTGG - Intergenic
1114518045 14:23313247-23313269 AGGCTTTTATAAATCCTAAGAGG - Intronic
1121089357 14:91170502-91170524 AGATTTTTAAAAATCCTCCCTGG + Intronic
1121224991 14:92315175-92315197 AGGTTTTTATGGGTCAAACCTGG - Intergenic
1128845249 15:70888726-70888748 AATTTTTAATAGATTCTACCTGG - Intronic
1135428179 16:22357814-22357836 AGGTTTTTATATATCAAACAAGG - Intronic
1138799134 16:60004733-60004755 TGGTTTTTATAGTTACTACCGGG + Intergenic
1140696194 16:77536531-77536553 AGGTTTTTAAAGAGCCCACCTGG - Intergenic
1147846230 17:43405790-43405812 AGGTTTTTATATATTCTTCTGGG + Intergenic
1154933302 18:21023946-21023968 TGGTTTTTATTTATCCTACTTGG - Intronic
1155602555 18:27566473-27566495 AAGATGATATAGATCCTACCTGG + Intergenic
1156161618 18:34366088-34366110 AAGTTTTTCTTGATCCCACCAGG + Intergenic
1158202181 18:54953350-54953372 TGCTTTTTTTAGATCCTGCCAGG - Intronic
1163659745 19:18569532-18569554 GGGTTGTTATAGCTCCCACCAGG - Intergenic
1167257206 19:48437888-48437910 AATTTTATATAGATCCTAACAGG - Intronic
925808538 2:7675724-7675746 AGGTTTTTATGGATCTTATGGGG + Intergenic
935316496 2:101839953-101839975 AGGATCATATAGATCGTACCAGG + Exonic
936729687 2:115365701-115365723 AGTTTTTCATAGATCTTACAAGG + Intronic
942552641 2:177135431-177135453 AGGTTTTTATAGGCCAGACCTGG + Intergenic
943395162 2:187324484-187324506 TGGTTTTTCTAGTTCCTAGCGGG - Intergenic
946078504 2:217096346-217096368 AGATTTTCAGAGGTCCTACCTGG + Intergenic
1179230713 21:39501451-39501473 TGGTTTTTTTAATTCCTACCAGG - Intronic
1182896593 22:33864083-33864105 TGGTTTGTACAGAACCTACCAGG + Intronic
1183606338 22:38868623-38868645 TGGGTTTTAGAGATCCTACTGGG + Intronic
1184229150 22:43149030-43149052 AGGGTTTTATGAATCCCACCCGG - Intergenic
955148527 3:56344222-56344244 AGGTTATTATACATTCTGCCAGG - Intronic
955910226 3:63852304-63852326 AGTTTTTTGTATATCCTTCCAGG - Intronic
956225194 3:66949786-66949808 AGGTTTTAAAAAATTCTACCTGG + Intergenic
961068124 3:123893387-123893409 AAGTTTTGATATATTCTACCTGG - Intergenic
961342900 3:126241234-126241256 ATTTGTTTATTGATCCTACCTGG - Intergenic
961917268 3:130390324-130390346 AGGTTTTTACAGATACAGCCTGG + Intronic
963167216 3:142216973-142216995 GGGTTTTTATAAATCCTATGAGG - Intronic
971005773 4:22373135-22373157 AGGGTTTTATGGATCATGCCTGG - Intronic
971663215 4:29447301-29447323 TGGTTTTTAGGAATCCTACCTGG - Intergenic
975658469 4:76665083-76665105 AGGATTTTACAGTTCTTACCAGG + Intronic
975970816 4:80034471-80034493 AGGCTTTTATAGAACCAACGTGG + Intronic
976516349 4:85971828-85971850 AGGATTCTATAGATCCTTCTAGG + Intronic
983766512 4:171490659-171490681 TGGTTCTTATAGATCCTCTCAGG - Intergenic
983851610 4:172587677-172587699 AGATTCTTATACATCCTTCCAGG + Intronic
984313116 4:178090203-178090225 AGGTTTTTATAGCTCAAACTGGG - Intergenic
984913185 4:184695013-184695035 AGTTTATTATAGCTCATACCTGG + Exonic
990754357 5:59052069-59052091 AGGTTATTATGGTTCCTTCCTGG - Intronic
992279277 5:75157073-75157095 TGGATGTTAAAGATCCTACCAGG + Intronic
995549237 5:113264626-113264648 ATGTTTTTGTAGAGCCTACAAGG + Intronic
998635629 5:143951859-143951881 AGGTTTTTCTGGCTCCAACCTGG + Intergenic
1004441362 6:15658399-15658421 AGGTTTTGGTAGATACTACAAGG + Intronic
1004568537 6:16822470-16822492 AGGTGTTTATAGAGCATTCCAGG - Intergenic
1005358258 6:25005980-25006002 AGGTTTATATATTTCCTTCCAGG + Intronic
1008740431 6:54600320-54600342 AGGTTTTTATATATTCACCCAGG + Intergenic
1010656713 6:78519983-78520005 AGGTTTTTCCAGACCCTCCCTGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015759156 6:136639124-136639146 ATGTTTTTTTAAAGCCTACCAGG + Intronic
1026873643 7:73867850-73867872 AGGTGCTTATAGGTCCTTCCTGG - Intergenic
1036521102 8:9492322-9492344 AGGTATTTTTAGATTCAACCAGG - Intergenic
1044616633 8:94149228-94149250 AGGTTTTAAAAGATACTTCCAGG - Intronic
1056334607 9:85554677-85554699 AAGTTTTTATACATAATACCTGG + Intronic
1192589678 X:72349555-72349577 AGCTTTTTAAAGATCCTAACAGG - Intronic
1195773606 X:108378646-108378668 TAGTTTTTATGGATCATACCTGG - Intronic
1200417992 Y:2933517-2933539 AAGTTTTTAGAGATGGTACCTGG - Intergenic