ID: 1091168814

View in Genome Browser
Species Human (GRCh38)
Location 11:133502746-133502768
Sequence CTCCTGAGAAGCAGAATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091168814_1091168819 27 Left 1091168814 11:133502746-133502768 CCCACTATTCTGCTTCTCAGGAG 0: 1
1: 0
2: 0
3: 25
4: 236
Right 1091168819 11:133502796-133502818 TGTGGCCAGAATTCCTGAGATGG 0: 1
1: 0
2: 0
3: 26
4: 182
1091168814_1091168817 9 Left 1091168814 11:133502746-133502768 CCCACTATTCTGCTTCTCAGGAG 0: 1
1: 0
2: 0
3: 25
4: 236
Right 1091168817 11:133502778-133502800 GTTGCCTATGTTTAAATGTGTGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091168814 Original CRISPR CTCCTGAGAAGCAGAATAGT GGG (reversed) Intronic
902842959 1:19086871-19086893 CTCAGGAGAAGCAGAATAGAGGG + Intronic
903943945 1:26950228-26950250 CTGCTGAGAAGGAGCAGAGTGGG + Intronic
903982805 1:27201968-27201990 CTCCTGAGTAGCTGAGTAGCAGG + Intergenic
904892627 1:33790868-33790890 CTCCAGAGAAACAGAACAATAGG - Intronic
905483819 1:38281587-38281609 CTGCTGAGAAGACGGATAGTTGG + Intergenic
906529903 1:46517779-46517801 CTCCCGAGTAGCTGAATAGCTGG - Intergenic
906911456 1:49955922-49955944 CTCATGAGAATTAGAATAGATGG - Intronic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
908504741 1:64785490-64785512 CTCCTGAGTAGCAGAATTACAGG + Intronic
909022973 1:70452654-70452676 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
909144201 1:71908421-71908443 CTCCAGACAAACAGAAGAGTAGG + Intronic
909659242 1:78063767-78063789 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
911781855 1:101889881-101889903 CTTCTGAGAAGTAGAATTATAGG - Intronic
913997088 1:143660565-143660587 CTCTTGAGAAGCAGAAGAAAGGG + Intergenic
914352369 1:146851760-146851782 CTCCTGAGTAGCTGAGTAGTTGG + Intergenic
914748759 1:150518228-150518250 CACATGGGAAGAAGAATAGTTGG - Intergenic
918657832 1:187050976-187050998 CTCCAGAGAAGCAGAACCATAGG + Intergenic
919885904 1:201934587-201934609 CTAATGGGAAGCAGAATAGTAGG - Intronic
920725950 1:208435462-208435484 CACGTGAGAAGAAGAATAGAGGG + Intergenic
921485154 1:215706349-215706371 CTCCCAAAAAGCAGAACAGTAGG - Intronic
921702412 1:218283542-218283564 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
924647796 1:245895215-245895237 CTCCAGACAAGCAGAAAAATGGG - Intronic
1064887415 10:20125185-20125207 CACTTGAGAAGCAGAGTATTAGG + Intronic
1065674726 10:28162658-28162680 GTCCTGAGAAGGAGAATCTTTGG - Intronic
1066213325 10:33261857-33261879 CTCCTGAGTAGCTGAATTATAGG + Intronic
1067717204 10:48698798-48698820 CTCCAGAGAAACAGAACAATAGG + Intronic
1069133406 10:64733686-64733708 CTCCTGAGTAGTAGAGTAGCTGG - Intergenic
1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG + Intronic
1070959569 10:80489211-80489233 CTTCTGAGAAGCAGAATCTGCGG - Exonic
1071194456 10:83141646-83141668 CAACTGAGAAGCAAAATAGTTGG + Intergenic
1075321210 10:121493021-121493043 CTTCTGAGAAGCGGACTTGTAGG - Intronic
1077081612 11:726893-726915 CTCCCTAGAAGCAGCAAAGTGGG + Exonic
1078242181 11:9539833-9539855 GTCCTGACAATGAGAATAGTTGG - Intergenic
1078670023 11:13356184-13356206 TACCTGAGAAGCAGAATATTTGG + Intronic
1078758164 11:14230909-14230931 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1080088238 11:28312783-28312805 CTCCTGAGAAGAGGATGAGTTGG - Intronic
1083239323 11:61374832-61374854 CTCCTGAGTAGCTGAATAGCTGG - Intergenic
1084115753 11:67042057-67042079 CTTCTGAGAGGCAGTATAGTGGG + Intronic
1084194332 11:67515803-67515825 CTCCAGAGAAACAGAACAATAGG - Intergenic
1085406278 11:76264902-76264924 CTCCTGTGTAGCTGTATAGTTGG + Intergenic
1086614114 11:88794182-88794204 GTCCCCTGAAGCAGAATAGTGGG - Intronic
1087672504 11:101124981-101125003 CTCCTTACAAGCAGAAAAGCAGG - Intronic
1089725427 11:120473786-120473808 CTCTTCAGAAGCATAAAAGTTGG + Intronic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1092184005 12:6465092-6465114 CCCCTGGGAAGCAGAAGGGTAGG - Intronic
1093569971 12:20655530-20655552 CTAGTGATAAGCAGAACAGTGGG - Intronic
1095515327 12:42999385-42999407 TACCTGAGAAGCATGATAGTGGG - Intergenic
1098377577 12:69833801-69833823 CTCCTGTGAAGCAGAAGATAGGG + Intronic
1098447198 12:70578405-70578427 CTCCTGTAAAGCACAATAATAGG - Intronic
1099294281 12:80810603-80810625 CTCCCCAGAAGCAGAATTGCTGG + Intronic
1101180131 12:102207305-102207327 CTCCTGACAAAGAGAATAGCAGG - Intergenic
1113681329 13:112247158-112247180 CTCCAGAGAAGCAGAGAAGCAGG + Intergenic
1113836092 13:113329461-113329483 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116086031 14:40238757-40238779 CTGCTGAGAAACTGAATATTTGG + Intergenic
1119133743 14:72197650-72197672 TTCAAGAGAAGCAGAATATTTGG - Intronic
1121049539 14:90811480-90811502 CTCCTGTGAAGAAGAGGAGTCGG - Intronic
1121230341 14:92352925-92352947 CTTCTGAAAAGCAGAATGTTGGG - Intronic
1122747183 14:103905330-103905352 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1202839840 14_GL000009v2_random:111474-111496 CTCTTGATGAGAAGAATAGTAGG - Intergenic
1125933747 15:43617662-43617684 CTCCTGAAAGGCAGCATAGAGGG + Exonic
1125946845 15:43717124-43717146 CTCCTGAAAGGCAGCATAGAGGG + Intergenic
1130351035 15:83091985-83092007 CTCCTGAGTAGCTGAGTAGCTGG - Intergenic
1131967886 15:97864980-97865002 CTCATGAAAAGCAGTAAAGTTGG - Intergenic
1135873154 16:26170694-26170716 CCCCTGAGAAGCTGAACAGATGG + Intergenic
1136413602 16:30091036-30091058 CTCCTGGGTAGGAGAATAGGGGG - Intronic
1136618552 16:31413069-31413091 CTCCTGAGGGGCAGAGTAGTGGG - Exonic
1139027396 16:62834987-62835009 CTCCAGAGAAACAGACCAGTAGG + Intergenic
1139061220 16:63254117-63254139 CTCCACAGAAGCAGAAGAGAAGG - Intergenic
1139438628 16:66952147-66952169 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1139981660 16:70863759-70863781 CTCCTGAGTAGCTGAGTAGTTGG - Intronic
1141533551 16:84663173-84663195 CTACTTAGAAGCAGAAAACTGGG - Intronic
1141557883 16:84848012-84848034 CTCCTGAGAAGTAGGATTGCTGG + Intronic
1143129513 17:4668269-4668291 CTCCTGAGTAGCTGAGTAGCCGG - Intergenic
1143277945 17:5727699-5727721 CTCTAGAGGAGCAGAAAAGTAGG - Intergenic
1143532885 17:7515869-7515891 CTCCAGAGAAGCAGAACCATTGG + Intergenic
1146768876 17:35550088-35550110 CACCAGAGAACCAGAATGGTAGG - Intronic
1147309740 17:39588253-39588275 CTCCTGAGAGGAAGAAAGGTGGG + Intergenic
1149641519 17:58205954-58205976 CTGCTGAGAACCAGAAAAGCTGG - Exonic
1151285768 17:73109965-73109987 GTCCTGAGAAATAGAAGAGTTGG + Intergenic
1153385959 18:4496440-4496462 ATCCTGAGAACCAGAATATTAGG - Intergenic
1155188116 18:23405082-23405104 CTCCTATGAACCAGAAAAGTGGG + Intronic
1155284654 18:24275258-24275280 CCCCAGAGAAGCAGAATGGAAGG + Intronic
1156247362 18:35314614-35314636 ATCCTGAGAAGCAATAAAGTTGG + Intergenic
1156669582 18:39452100-39452122 CTCCTAAGACTCAGAATAATTGG + Intergenic
1156862836 18:41858368-41858390 CTCCTGAGAAGCAGTATTAGGGG - Intergenic
1158598792 18:58839341-58839363 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1161244191 19:3240129-3240151 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1161914417 19:7217978-7218000 CTCCTGAGCAGCAGATTCTTGGG - Intronic
1162862005 19:13513132-13513154 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
1168118444 19:54239260-54239282 CTCCTGAGAATCAAAACAGAAGG + Intronic
925120741 2:1415849-1415871 GTCCTGAGATGCAGAAAAATTGG - Intronic
925375722 2:3383519-3383541 CTCCCGAGTAGCAGAGTAGCTGG + Intronic
927888247 2:26731453-26731475 CTCCTGAGTAGCCGAGTAGCTGG - Exonic
928933050 2:36645437-36645459 CTCCAGTTAAGCAGTATAGTGGG + Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930162544 2:48172932-48172954 CTACTGAGGAGAAAAATAGTAGG - Intergenic
931028912 2:58148047-58148069 CTCCTGAGATGTAGAATTGCTGG + Intronic
931701789 2:64915046-64915068 GTCCTGAGAAGCACTATAGAGGG + Intergenic
934926664 2:98386683-98386705 GTCCTTAAAAGCAGAAGAGTGGG + Intronic
935768005 2:106388440-106388462 CACCTGTGATGCAGAATATTTGG - Intergenic
936558344 2:113515183-113515205 GTCCTTAGAAGAAGAATAGAGGG - Intergenic
938918930 2:135974523-135974545 CTCCTGACAAACAGAAAACTTGG + Intronic
940418299 2:153448704-153448726 GTCCTGAGATGCAGAAAAGGGGG - Intergenic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
942602233 2:177653162-177653184 ATCCCCAGAAGCAGAAAAGTGGG - Intronic
945141107 2:206686941-206686963 CTCCTGAGGAGCAGAGTGGATGG + Intronic
948746902 2:240103284-240103306 CTCCAGAGAAACAGAATATATGG + Intergenic
948874521 2:240819742-240819764 CTCCAGGGAAGCGGAATAGCCGG + Intronic
1169313976 20:4572690-4572712 CTTCTGACATGCAGAATTGTTGG - Intergenic
1169632877 20:7652728-7652750 CTCCTGAGAAGAAGAAAAGATGG - Intergenic
1169794997 20:9452440-9452462 CTCTTGAGAACCAGAAAAATGGG - Intronic
1169832490 20:9839311-9839333 GGGCTGAGAAGCAGAACAGTGGG + Intergenic
1173427362 20:42954830-42954852 ATCCTTAGAATCACAATAGTAGG + Intronic
1176057682 20:63157369-63157391 CTCCTCAGAAACAGAATCCTAGG + Intergenic
1176152028 20:63596335-63596357 CTCCGGAGAGGCAGAAGAGAGGG - Intronic
1176962981 21:15180678-15180700 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1177696640 21:24581562-24581584 TTCTTGAGAACAAGAATAGTTGG + Intergenic
1177746116 21:25214955-25214977 CTCTTGAGAAGCAGACCAGTGGG - Intergenic
1177781547 21:25627211-25627233 CTCCTGAGAAACAGAAATCTTGG + Intergenic
1178133627 21:29601430-29601452 CTCCAGAGAAACAGAACAATAGG - Intronic
1178404489 21:32313028-32313050 CTCCAGAGATGCAGAAAAGAAGG + Exonic
1178715727 21:34962777-34962799 CTTCTGAGAAGCAAATGAGTAGG + Intronic
1178736394 21:35156311-35156333 CTCCAGAGAAACAGAATGGTTGG + Intronic
1178830399 21:36051570-36051592 CTACAGAGAGGCAGAATAGGTGG + Intronic
1179602401 21:42488956-42488978 CTCCTGAGAAGAAATATAGTTGG - Intronic
1180691495 22:17720289-17720311 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1181600797 22:23950832-23950854 CTCCTCCTAAGTAGAATAGTTGG + Intergenic
1181607715 22:23990503-23990525 CTCCTCCTAAGTAGAATAGTTGG - Intergenic
1182009712 22:26990263-26990285 CTCCAGAGAAGCAGAATCTTCGG + Intergenic
1182748834 22:32625927-32625949 TTCCTGTGATGCAGAATATTTGG - Intronic
1183996165 22:41634307-41634329 CCCCTGAGTAGCTGAGTAGTGGG + Intronic
1185367043 22:50441543-50441565 CGCCTCAGAAGCAGGATAGTAGG + Intronic
949280389 3:2340027-2340049 TTCCTAAGAAGAAGAATATTTGG - Intronic
949391105 3:3563472-3563494 CTCCAGAGAAGTAAAATAGTGGG + Intergenic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
950613911 3:14144296-14144318 GTTCTGAGAAACAGAAGAGTAGG - Intronic
950744595 3:15076996-15077018 CTCCTGGGAAGCAAAAGAGCAGG + Intronic
954415930 3:50393340-50393362 CCCTTGAGAACCAGACTAGTTGG - Intronic
954694392 3:52413371-52413393 CACCTGAGATTCAGAGTAGTTGG + Intronic
955819897 3:62885699-62885721 CTCCTTGGAAGCAGAAAACTTGG - Intergenic
956957821 3:74361056-74361078 CTTGTGATAAGCAGAATAATTGG - Intronic
957509074 3:81164332-81164354 TTAATGAGAAGCAGAATAGAAGG - Intergenic
957973626 3:87415220-87415242 CTCCTGTAAAGCAGAAAATTTGG - Intergenic
959967069 3:112368252-112368274 CTCTTGAGAAGTATCATAGTAGG + Intergenic
963204183 3:142615614-142615636 CTCCTGGGAAGAAGGATATTAGG - Intronic
964384142 3:156129309-156129331 CCCCAGAGAAGCAGAGTATTCGG - Intronic
965774656 3:172215879-172215901 GTTCTGATAAGCAGAATAGGGGG + Intronic
966558020 3:181285634-181285656 TTCCTGAGAGGCAGTTTAGTGGG + Intergenic
966827602 3:183978201-183978223 AAGCTGAGAAGCAGAAGAGTGGG - Intronic
967161548 3:186743373-186743395 TTTTTGAGAAGCAGAATAATAGG + Exonic
967605418 3:191439536-191439558 CTCCTGACAAGCAGAATCCCAGG - Intergenic
968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG + Intronic
969119329 4:4896081-4896103 CTCCAGAGAAACAGACCAGTAGG - Intergenic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
970349701 4:15189689-15189711 CACCAGAGAAGCAGAATAATAGG - Intergenic
970360134 4:15300994-15301016 CTTCTGAGAAGCAGAGTGGAGGG - Intergenic
970811673 4:20101638-20101660 GTCCTGGGAAGCAGCAAAGTCGG + Intergenic
972410977 4:38794336-38794358 CTTCTTTGAAGCATAATAGTGGG - Intronic
973106034 4:46338859-46338881 CTACTGAGAAGTAGAAAGGTTGG + Intronic
974314044 4:60254343-60254365 CTCCTAAGAAACAGAAGAGGAGG + Intergenic
974460590 4:62182428-62182450 CTGCAGAGAAGCAGAAAATTGGG - Intergenic
976047087 4:80963355-80963377 CTCCTGAGAAAAAGACTAGGGGG + Intronic
977482202 4:97593130-97593152 CTCCTGGGAAGCACCCTAGTTGG - Intronic
978593134 4:110348071-110348093 CTCTTGAGAAACAGAAAATTTGG - Intergenic
979342819 4:119547803-119547825 TTTCTGAAAAGCAGAATTGTTGG - Intronic
979572131 4:122239860-122239882 TTCCTCAGCAGCAGAAAAGTAGG - Exonic
979918203 4:126466094-126466116 CACATGAGAAGCAAAATATTAGG + Intergenic
980014231 4:127630318-127630340 CTCCTGAGTAGCAGCCCAGTAGG + Intronic
981800276 4:148647722-148647744 CTCCTGAGTAGCTGAGTAGCTGG - Intergenic
982156527 4:152527655-152527677 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
982209438 4:153022599-153022621 CTCCTGGGCAGCAGAATGGTGGG + Intergenic
983250470 4:165339749-165339771 CTCCAGTGAAGCAGAATCATTGG + Intronic
983769989 4:171537089-171537111 CTTCTGAGAAAAAGAAAAGTGGG - Intergenic
986299770 5:6468690-6468712 CTCCTAAGAAGTAGAATTGAAGG - Intronic
989814111 5:45714575-45714597 GTCCAGAGCAGCAGAAGAGTAGG + Intergenic
991659258 5:68933850-68933872 CTCCTGGGAAACAAGATAGTTGG - Intergenic
992217456 5:74539990-74540012 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
992593699 5:78324121-78324143 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
993708774 5:91201212-91201234 CTCCTGAGTAGCAGAATCACAGG - Intergenic
993720591 5:91317912-91317934 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
994226578 5:97258563-97258585 ATCCTCAAAAGCAGAATAGAAGG + Intergenic
996020807 5:118588972-118588994 CTCCTGAGCAGCAGGAGAGGTGG - Intergenic
996932173 5:128903158-128903180 CTCATGCCAAGCAGAGTAGTGGG - Intronic
996937573 5:128965958-128965980 ATCCTGAGAAACAGAATCGTAGG - Exonic
998415691 5:141944756-141944778 CAGCTGAGAAGCAGATTAGTTGG + Exonic
999571755 5:152926596-152926618 CTCCTGAGAAGAAGAGCACTAGG - Intergenic
1001047871 5:168389143-168389165 CACATGAGAAGCACTATAGTAGG + Intronic
1001775423 5:174325944-174325966 CTCCAGAGAAGCAGAAGGGCTGG + Intergenic
1002851585 6:1001618-1001640 CTTCTGAGAGTCAGAATGGTTGG + Intergenic
1004216259 6:13706885-13706907 CTCCTGAGTAGCTGAGTAGCTGG - Intronic
1004594195 6:17083711-17083733 ATCCTGAGATGTAGAATAGCAGG + Intergenic
1004734049 6:18387200-18387222 GTCCTGACAAGCAGTAGAGTCGG + Intergenic
1004911526 6:20290007-20290029 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1006405253 6:33841360-33841382 GGCCTGAGAAGCTGAATTGTGGG - Intergenic
1007013802 6:38442609-38442631 CTCCTGTGAAGAAGGAAAGTTGG + Intronic
1007149233 6:39671592-39671614 GGCGTGAGAAGCACAATAGTGGG - Intronic
1010625092 6:78129268-78129290 TTCCTGAGAAGGAGAACTGTTGG + Intergenic
1011720140 6:90147558-90147580 CTCCTTAGAAGAAGACTAGGTGG - Intronic
1012213321 6:96551164-96551186 CTTGTGAGAAACAGAATATTTGG - Intronic
1013637669 6:112044580-112044602 CTCCTGGGAAGCACAGTAGAAGG - Intergenic
1014304991 6:119728530-119728552 GTCCTGAGAACCAGGAGAGTTGG + Intergenic
1016090466 6:139971832-139971854 ATTCTAAGAAGCAGAATACTTGG + Intergenic
1016250251 6:142032193-142032215 CTCCTGAGTAGCTGAGTAGTTGG - Intergenic
1018647193 6:165959752-165959774 CACCTGGGAAGCAGGAAAGTGGG - Intronic
1019899501 7:4008908-4008930 ATACTGAGAAGCAGAATTGCTGG + Intronic
1021900491 7:25280204-25280226 ATCCTGAGAAAGAGAAAAGTAGG - Intergenic
1022732539 7:33043664-33043686 CTCCTTAGAATCAGACTAGCAGG - Intronic
1023655971 7:42421547-42421569 CTCCTGAGAGGTAGAATAAGAGG - Intergenic
1023935191 7:44734652-44734674 CTCCTGAGTAGCTGAATTATAGG - Intergenic
1024736527 7:52311095-52311117 CTCCAGAGAAACAGAATAAGTGG + Intergenic
1027128057 7:75571263-75571285 CTACTGAGCAACAGAATACTTGG + Intronic
1028596319 7:92549571-92549593 CTCCAGATTAGCAGATTAGTTGG + Intergenic
1029415805 7:100442429-100442451 CTGCTGGGATGCAGAAAAGTTGG + Intergenic
1029889028 7:103906777-103906799 CTCCTGAGTGGCAGAAAAGGAGG + Intronic
1034098514 7:148431481-148431503 CTCCAGAGTAGCAGAGTAGCTGG - Intergenic
1034557792 7:151860920-151860942 CTACCTAGAAGCAGAATACTGGG - Intronic
1034720940 7:153292131-153292153 CTCCTAAGAAAAAGAATAGGAGG + Intergenic
1036461661 8:8958968-8958990 CTCCTGAGAAGTGGGAGAGTTGG - Intergenic
1036466470 8:9002661-9002683 TTCCTGAGAAGGAAAAAAGTAGG - Exonic
1036525472 8:9530564-9530586 CTCCAGAGAAGCAGAATCACGGG + Intergenic
1036825191 8:11970439-11970461 GTCCTCAGAAGCAGATGAGTGGG + Intergenic
1037367845 8:18142013-18142035 CTGCTGGGAAACAGAATAATTGG - Intergenic
1037367995 8:18143361-18143383 CTGCTGGGAAACAGAATAATTGG - Intergenic
1037801747 8:22039812-22039834 CTGCTGAAAAACAGAAGAGTTGG - Intergenic
1038056663 8:23864974-23864996 ATCCTGAGATGCAGTATGGTGGG + Intergenic
1038621488 8:29147460-29147482 CTCCTGAGAAGCAGAACTGCCGG - Exonic
1044448465 8:92305847-92305869 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1045870226 8:106918228-106918250 CACCAGAGATGCAGAATAGAAGG + Intergenic
1046221689 8:111225352-111225374 CTCCTCAGAAACAGAATAAATGG - Intergenic
1046343455 8:112889676-112889698 GTCCTGTGAAACAGAAAAGTTGG + Intronic
1048153637 8:131919471-131919493 CTCCTGAGTAGCTGAGTAGTGGG - Intronic
1048183257 8:132215602-132215624 CTCCTCAGAGGCAGAAGCGTGGG - Intronic
1048720242 8:137315457-137315479 TTTCTGAAAAACAGAATAGTTGG - Intergenic
1049894523 9:101083-101105 GTCCTTAGAAGAAGAATAGAGGG + Intergenic
1050778725 9:9302998-9303020 TTACTGACAAGCAGTATAGTAGG - Intronic
1051587581 9:18743037-18743059 CTCTTGAGAAACAAATTAGTAGG - Intronic
1052710020 9:32042609-32042631 CTCCTGAAATTCAGAATAGGAGG - Intergenic
1052937918 9:34108866-34108888 CTCCTGAGTAGCTAAGTAGTTGG - Intronic
1053735730 9:41101073-41101095 GTCCTTAGAAGAAGAATAGAGGG + Intergenic
1054692647 9:68330325-68330347 GTCCTTAGAAGAAGAATAGAGGG - Intronic
1054788721 9:69235012-69235034 CTCCAGAGAAACAGAATGATAGG + Intronic
1055078879 9:72246951-72246973 CTACTGATAAGCAGAAAAGAGGG - Intronic
1056472518 9:86919771-86919793 CTCCTGAGTAGCTGAGTAGCTGG + Intergenic
1056622768 9:88228078-88228100 CTCCAGAGAAACAGAGTGGTAGG - Intergenic
1057363363 9:94395907-94395929 CTCCTGAGTAGCTGAGGAGTGGG + Intronic
1057659973 9:96992191-96992213 CTCCTGAGTAGCTGAGGAGTGGG - Intronic
1058528531 9:105883996-105884018 CTCCTGAGCATCAGAAGAGAAGG + Intergenic
1058845870 9:108958846-108958868 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1062688070 9:137826579-137826601 CTCCTGAGAACCAAACCAGTAGG - Intronic
1187848915 X:23571327-23571349 TTCCTCACAAGCAAAATAGTTGG - Intergenic
1189229097 X:39438202-39438224 CTACTGAGAGGCAGAATAGGAGG - Intergenic
1190193530 X:48296918-48296940 GTCCTGTGATGGAGAATAGTTGG + Intergenic
1190660044 X:52645541-52645563 GTCCTGTGATGGAGAATAGTTGG + Exonic
1190666218 X:52698086-52698108 GTCCTGTGATGGAGAATAGTTGG + Exonic
1190673200 X:52760324-52760346 GTCCTGTGATGGAGAATAGTTGG - Exonic
1193278435 X:79619801-79619823 ATCCAGAGAAGCACAGTAGTAGG + Intergenic
1194102333 X:89721189-89721211 CTCCTGAGTAGCTGAGTAGGTGG + Intergenic
1194675878 X:96793281-96793303 CTCCTGAGTAGCTGAGTAGCTGG + Intronic
1194709268 X:97215189-97215211 ATCCTGAGAGGCAGACCAGTAGG - Intronic
1200454921 Y:3378467-3378489 CTCCTGAGTAGCTGAGTAGGTGG + Intergenic