ID: 1091169313

View in Genome Browser
Species Human (GRCh38)
Location 11:133506379-133506401
Sequence AAGCACCTCCAAAATGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091169311_1091169313 1 Left 1091169311 11:133506355-133506377 CCTGCAAATGGCTTGGCACATAA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1091169308_1091169313 9 Left 1091169308 11:133506347-133506369 CCCTAGTGCCTGCAAATGGCTTG 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1091169305_1091169313 26 Left 1091169305 11:133506330-133506352 CCCTGAGAGGGTTACTTCCCTAG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1091169306_1091169313 25 Left 1091169306 11:133506331-133506353 CCTGAGAGGGTTACTTCCCTAGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1091169309_1091169313 8 Left 1091169309 11:133506348-133506370 CCTAGTGCCTGCAAATGGCTTGG 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091169313 Original CRISPR AAGCACCTCCAAAATGCTCA GGG Intronic
900506879 1:3033789-3033811 CAACACGTCCAAAATGCTCACGG - Intergenic
901126101 1:6929902-6929924 CAGCACCTCCTAGGTGCTCATGG - Intronic
901858217 1:12057666-12057688 GAGCACAGCTAAAATGCTCATGG - Intergenic
906381460 1:45334630-45334652 AAGCACTCTCAAGATGCTCACGG + Intronic
909470262 1:76019945-76019967 AAGCACCTCAAAACTCATCATGG - Intergenic
910477996 1:87627931-87627953 AAACACCTCTAAATTACTCATGG + Intergenic
910643317 1:89488076-89488098 AACCTACTCCAAAATGCTGAGGG - Intergenic
911184068 1:94886169-94886191 AAGCACCTCCACAATGCCTACGG - Intronic
912497444 1:110100665-110100687 TAGCAGCTCCAAAAAGCCCAGGG - Intergenic
915073568 1:153291843-153291865 CAGCATGTCCAAAATGCTGACGG + Intergenic
915168307 1:153960765-153960787 AAGCAGCAGCAAAATGTTCAGGG + Intronic
917034258 1:170729691-170729713 CATCACCTCTAACATGCTCAAGG - Intronic
917726353 1:177831220-177831242 AAGCTCATCCAAATTGCTGATGG + Intergenic
919376655 1:196803070-196803092 AAGCAAGTCCAAAATTCACAGGG - Intergenic
919386361 1:196927958-196927980 AAGCAAGTCCAAAATTCACAGGG - Intronic
919579520 1:199354541-199354563 AAGCCCCTTCAAAGTCCTCAAGG - Intergenic
919786619 1:201262216-201262238 GAGCAGCTCCCAACTGCTCAGGG - Intergenic
920951158 1:210572905-210572927 AGGCAACTGCAAAATGCACAGGG - Intronic
921543865 1:216450987-216451009 AAGCCTCTCCCAAAAGCTCAGGG - Intergenic
921821592 1:219623079-219623101 AATCACCTCCCAAAGGCTCTAGG - Intergenic
922638202 1:227198638-227198660 ATGCAACTCTATAATGCTCATGG - Intronic
1062846130 10:707143-707165 AGGCACCTCCAAGATCTTCAAGG - Intergenic
1065386921 10:25143147-25143169 AAGCAACTCCTAAATGCCAAAGG + Intergenic
1066044601 10:31584357-31584379 AAGCACCTCCCAGCTGGTCAAGG - Intergenic
1066382787 10:34915632-34915654 GAGCACCCCCAAAATTCTGAGGG - Intergenic
1070392924 10:75986917-75986939 ATGCACCTCCAAAATCATCTTGG - Intronic
1070949026 10:80416038-80416060 ATGCACTTCCAAAATGTTCCTGG - Intronic
1071030748 10:81177923-81177945 AAGGACAACCAAAATGCTTAAGG - Intergenic
1072089951 10:92117670-92117692 AACAACCTCCAAAATGTTCTTGG + Intronic
1072607346 10:96995897-96995919 AAGCGCCTTGAAAAAGCTCATGG - Intergenic
1074490159 10:113932769-113932791 AGGCACCAACAAAACGCTCAGGG - Intergenic
1074860802 10:117508879-117508901 AAATTCCTCCAAAATCCTCATGG - Intergenic
1076415669 10:130286537-130286559 CAGCATCTGCACAATGCTCAGGG - Intergenic
1078718361 11:13860796-13860818 ATGCATCACCAAAATGGTCAGGG + Intergenic
1080441120 11:32295489-32295511 AAGCATCTATAAAATGTTCATGG + Intergenic
1082833048 11:57633720-57633742 AAGCACCTCCAGAATAGTCTTGG + Intergenic
1083003596 11:59320726-59320748 GAGCACCTCCAACAGGCTGAGGG - Intergenic
1086471246 11:87114003-87114025 AAGCACCTTCACAATTCTGAAGG + Intronic
1089594269 11:119567194-119567216 AGGCCCCACCACAATGCTCATGG - Intergenic
1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG + Intronic
1093752024 12:22810400-22810422 AAACATCACAAAAATGCTCATGG + Intergenic
1094010895 12:25808276-25808298 TATCACCTCCCAAATGCTCAAGG - Intergenic
1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG + Intronic
1099754395 12:86824872-86824894 AAATACCTTCAAAGTGCTCAAGG + Intronic
1100088749 12:90943846-90943868 AACCATCTTAAAAATGCTCATGG - Intronic
1100676727 12:96876909-96876931 AACCACCTCCCACTTGCTCAGGG - Intergenic
1103141955 12:118556482-118556504 AAGCACCTAGAAAATACTAAGGG + Intergenic
1103173179 12:118839764-118839786 AAACAACTCCAAAATGTCCATGG - Intergenic
1106345009 13:28868160-28868182 ATGCACATCCAAAATCCTCTAGG - Intronic
1107432859 13:40355484-40355506 AAGCACCTCCAACTTGCACCTGG + Intergenic
1108117108 13:47140780-47140802 ATCAGCCTCCAAAATGCTCATGG - Intergenic
1108462817 13:50684240-50684262 AAGCTCCTACAAAGTGCTCTGGG - Intronic
1110288392 13:73776542-73776564 AAGCACTTTCAAAATGCACCGGG + Intronic
1113045990 13:106155549-106155571 AATCACCTCCAAAATGGAAAAGG + Intergenic
1113547238 13:111163206-111163228 AACTACCTACAAAATGTTCAGGG - Intronic
1113614158 13:111669408-111669430 GAGCAGCTCCGAAATGCTCAGGG - Intronic
1113619625 13:111754322-111754344 GAGCAGCTCCGAAATGCTCAGGG - Intergenic
1118968366 14:70609736-70609758 AAGCAACTCCTAAATGCCAAAGG - Intergenic
1120407830 14:84111253-84111275 AACCACATCCAAAATGCTGATGG - Intergenic
1126495627 15:49287185-49287207 AAGTACCTCTAAAATGCATATGG - Intronic
1126608789 15:50507359-50507381 AAGCACCAACATGATGCTCAAGG - Exonic
1128748597 15:70132473-70132495 AAGCACCTGCAAGATCCTCTGGG - Intergenic
1129770253 15:78198855-78198877 TAGCAAACCCAAAATGCTCATGG + Intronic
1130673441 15:85932447-85932469 TAGCAACTCCAAAATGGGCAGGG + Intergenic
1131123944 15:89842562-89842584 CAACACCTACAAAATTCTCAAGG + Intronic
1132246475 15:100300134-100300156 AAATACCTCCAACATGCCCAGGG + Intronic
1133532365 16:6666894-6666916 CAGAACCATCAAAATGCTCACGG + Intronic
1139956043 16:70693514-70693536 AAGCACCTCCCAGACGCTCCGGG - Intronic
1141477686 16:84284538-84284560 AGGCACCTCCCAAGTGCTGAGGG + Intergenic
1141630176 16:85283372-85283394 AAGCAGAGCCAAGATGCTCAGGG - Intergenic
1143988217 17:10933854-10933876 CTGTATCTCCAAAATGCTCATGG + Intergenic
1148996688 17:51716404-51716426 AAGGATGTCTAAAATGCTCATGG + Intronic
1150069540 17:62139537-62139559 CAACACCTCCAAGCTGCTCAGGG - Intergenic
1151223885 17:72634276-72634298 AAGCATCCCCAAAAACCTCAAGG + Intergenic
1153621692 18:6984913-6984935 AAGCACCTACTGAATGCTCAGGG - Intronic
1155014847 18:21823682-21823704 AAGCACAACCAAAGTACTCAGGG - Intronic
1155548943 18:26944449-26944471 AAACACTTCCAAAGTGGTCATGG + Intronic
1155635302 18:27946121-27946143 AAATACATCCAAAAAGCTCATGG + Intergenic
1155780566 18:29827604-29827626 AAGCAGATCCAAAATGACCAGGG + Intergenic
1157017958 18:43742054-43742076 AAGCACCTGTATATTGCTCACGG - Intergenic
1158140304 18:54248288-54248310 AGGCACATCCAAAATACCCATGG + Intergenic
1160727663 19:624733-624755 CAACACCTCCAAGCTGCTCAGGG - Exonic
1165354515 19:35295494-35295516 ACCCACCTCCAACCTGCTCAGGG - Intronic
1165665249 19:37622286-37622308 AAGCACCACCAGATGGCTCAAGG + Intronic
1166592850 19:44016557-44016579 AAGCAATTCCAAAATGCATATGG - Intergenic
929232442 2:39573454-39573476 AATCATCTCCAAATTGCTCAAGG + Intergenic
929544242 2:42845413-42845435 AAGAAGCTCCAAACAGCTCACGG + Intergenic
931959255 2:67463943-67463965 CAGCACCTGCAAACAGCTCAGGG + Intergenic
933773477 2:85758106-85758128 AAGCATCTCCAAGGTCCTCAGGG + Intronic
938089171 2:128419519-128419541 CAGCACCTTCAAAATTCCCAAGG - Intergenic
938748935 2:134310160-134310182 AAGCACCTCCAAGGGCCTCATGG - Intronic
939254234 2:139721830-139721852 AAGCGCCTCTAAACTGCCCAGGG + Intergenic
939507159 2:143059821-143059843 AAGCCCTTCCAAAATGATAAGGG + Intergenic
939634417 2:144563848-144563870 AAGTACATTAAAAATGCTCAGGG + Intergenic
941171841 2:162147223-162147245 AAACATCTTCAAAATGATCAGGG + Intronic
941250519 2:163156138-163156160 AAGTACCTGCAAAATAGTCAGGG - Intergenic
941714887 2:168753688-168753710 CAGCACTTCCAAAATTTTCAGGG + Intronic
943212180 2:184981088-184981110 AAGCAACTCTGAAATGCACAGGG + Intergenic
943688017 2:190839826-190839848 AAGCACTGCCAAACTGCTGAAGG - Intergenic
944382406 2:199126794-199126816 AAGCACATCCAGAATACTTAAGG + Intergenic
944941871 2:204637179-204637201 AAGGACATGCAAAATGCTCCTGG - Intronic
945103005 2:206280106-206280128 AAGCATATTTAAAATGCTCAAGG - Intronic
945957587 2:216100448-216100470 AAGCAACTCCACAATGCTGTAGG - Exonic
1171213337 20:23333983-23334005 CATCACCTGCAAAATGATCAAGG + Intergenic
1173041406 20:39467134-39467156 AAGAACCTCCAAAAAGCTGGAGG - Intergenic
1173596361 20:44261029-44261051 AGGCACCTTCAAATGGCTCAGGG - Intronic
1175109495 20:56636960-56636982 AAGCAGCTCAAAAATACTCATGG - Intronic
1175733121 20:61367535-61367557 AAGCCCCTTCAAGCTGCTCAAGG - Intronic
1178273598 21:31216398-31216420 CATGACCTCCAAAATGCTGAAGG + Intronic
1178802601 21:35810212-35810234 AATCAGCTCAAAAATTCTCAAGG - Intronic
1183352237 22:37340774-37340796 GAGCACCTGCTGAATGCTCAGGG + Intergenic
1184898628 22:47428427-47428449 AAAAACCTCCAAAATGGTCGTGG + Intergenic
949315858 3:2754348-2754370 AAGTACTTCCAAATTGCTAATGG + Intronic
949415929 3:3814144-3814166 AAGCACTTCCAATAAGCTAAAGG - Intronic
953350310 3:42210339-42210361 ATGCACCTCCAAGATGGGCAGGG - Intronic
954460153 3:50621885-50621907 AAGAGCCTCCAAAATGCTTTAGG - Intronic
954468359 3:50671491-50671513 AAGAGCCTCCAGAATGCTCATGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955661962 3:61309417-61309439 ATGCATCTTCAAAATGCTCATGG + Intergenic
956643117 3:71432988-71433010 AAGCAGGTACAAAATGATCAGGG - Intronic
962274814 3:134004023-134004045 AAGCAGCTTCAAAATTCACAGGG - Intronic
965109706 3:164405004-164405026 AAGGACCTGCAATATGATCAGGG - Intergenic
965206001 3:165719852-165719874 AAGCACCTCCAAAAATGTCAGGG + Intergenic
968471225 4:783320-783342 AGGCACCACCAAATTGCCCAGGG - Intergenic
968812025 4:2804487-2804509 AAGCAGCTCCTAACTCCTCAAGG + Intronic
970063751 4:12067494-12067516 AAGGACCTACAAATAGCTCATGG - Intergenic
970448313 4:16142265-16142287 ACGCACCTCAAATATGCTCCAGG - Intergenic
970686491 4:18573453-18573475 AAGCAGCTCTTAAATGCTGAAGG + Intergenic
970984892 4:22145800-22145822 AGACTCCTCCAAAAGGCTCATGG - Intergenic
979720696 4:123896726-123896748 AAGCATGTACAAAATGCTAAAGG + Intergenic
980968852 4:139550284-139550306 AAGCACCTCCTTAATGTGCAAGG - Intronic
983306365 4:165994411-165994433 AAGTACCTCTACAATTCTCAGGG + Exonic
983477012 4:168225637-168225659 AAGCATCACTAAAATCCTCAGGG + Exonic
986485081 5:8227944-8227966 AAGTACCTGCAAAATGTTAAAGG - Intergenic
991578774 5:68132717-68132739 AAGCCCCTTCAATCTGCTCATGG - Intergenic
992076837 5:73199639-73199661 AAGCAACCCCCAAATGCTGAAGG + Intergenic
1001258461 5:170204002-170204024 ATGCACCTCCACAATGCTATGGG - Intergenic
1004023379 6:11795313-11795335 AATCTCCTCTAGAATGCTCATGG + Intronic
1004979398 6:21006390-21006412 AACCACCTCCAAAATACTTTAGG + Intronic
1005395826 6:25381180-25381202 AAGCACCACCAAATTGCAGAAGG + Intronic
1006529793 6:34641817-34641839 AAGCATCTTCAAAAAGTTCATGG + Intronic
1007063651 6:38967145-38967167 AGGCACCTACAAAAAACTCACGG + Intronic
1008900894 6:56614651-56614673 ATGCACCTCCAAAATGTTTATGG + Intronic
1013332334 6:109116477-109116499 AAGTATCTCTAAAATGCTTATGG - Intronic
1016221210 6:141672057-141672079 AAACTCCTCCAAAAGGCTCCTGG + Intergenic
1017524111 6:155227860-155227882 AAGCACATCTAAGATGCCCAAGG + Intronic
1019959569 7:4447916-4447938 ATGCACCTGCAAAAGTCTCAAGG - Intergenic
1021120734 7:16792579-16792601 AAACACACACAAAATGCTCAAGG - Exonic
1022055601 7:26730565-26730587 AAACACCTCAAAAATTCTGAAGG - Intronic
1024512507 7:50214695-50214717 AAGCACCACCACACTGCTCTGGG - Intergenic
1026876519 7:73882142-73882164 AAACACATCCAAAATGCAGAGGG - Intergenic
1027845556 7:83369554-83369576 AAGCACCTGCAAAAGACTTATGG - Intronic
1033366468 7:140675825-140675847 AAGGACCTCCTTCATGCTCAGGG + Intronic
1033448216 7:141440176-141440198 AGGCACCTCCCAAAAGCACAGGG + Intronic
1033598898 7:142875177-142875199 AAGAACAGTCAAAATGCTCAGGG + Intronic
1035578347 8:723459-723481 AAGCACCTCCAAGCTGGCCATGG - Intronic
1035939524 8:3881824-3881846 AAGCAAATCCACACTGCTCAGGG + Intronic
1036685650 8:10908232-10908254 AAGGAAATCGAAAATGCTCAAGG + Intronic
1036734915 8:11304425-11304447 AAGCACATCCACAATTATCACGG - Intronic
1038298047 8:26314623-26314645 AAACACCTCCCAAATTCTAACGG - Intronic
1039228018 8:35411181-35411203 AAGCACCTCCATGGTGCTCATGG - Intronic
1040482939 8:47842600-47842622 AAGCAACTCCAAAAAGATAAAGG + Intronic
1042193089 8:66208047-66208069 AAGCATCTCCAAGATTCCCAGGG + Intergenic
1044679204 8:94760069-94760091 CAGAACCTTGAAAATGCTCAGGG + Intronic
1045323287 8:101098047-101098069 CAGCACCTCCAGAGTGCCCAGGG - Intergenic
1045759569 8:105588298-105588320 AATTACCCCCAAAATACTCACGG + Intronic
1045780681 8:105859548-105859570 AATGACCTCCAAAATGGTAAGGG + Intergenic
1046688280 8:117252021-117252043 AAGCACCTTCAAAAATCTAAAGG - Intergenic
1047351234 8:124076516-124076538 AAGTACCACCAAATTCCTCAGGG - Intronic
1047670654 8:127142705-127142727 AAGCACTTCCAGAAAGCTCCAGG - Intergenic
1047920451 8:129629497-129629519 AAGCATCTCCAAAGTGTTCAAGG + Intergenic
1049402572 8:142436145-142436167 AAGCACCCCAAAGATGCCCATGG + Intergenic
1050006858 9:1141132-1141154 AAGCTCTGCCAAAATGCACAAGG + Intergenic
1050012513 9:1199624-1199646 AACCACCTACACCATGCTCAGGG - Intergenic
1050217528 9:3344414-3344436 GAGCACCAACATAATGCTCAAGG - Intronic
1053161421 9:35815683-35815705 TAAAATCTCCAAAATGCTCAAGG - Intronic
1055035973 9:71818932-71818954 AAGCTCCTCCAAAAAGATCAAGG + Intergenic
1055231728 9:74074504-74074526 AAACATCTCCAAATTGCTCCTGG - Intergenic
1056384018 9:86080699-86080721 AAGCACCCCCAGAATTCCCACGG + Intronic
1057090210 9:92251040-92251062 AAGCACCTCTAGAATTCTGAAGG + Intronic
1061937297 9:133864823-133864845 AAGCCCCTCCACAATGGACAGGG + Intronic
1186477092 X:9865972-9865994 AGGCACCGCCAAGATGCCCAAGG - Intronic
1188235474 X:27725297-27725319 AAGGACATGCAAAATGCCCAAGG + Intronic
1190008545 X:46762051-46762073 AAGCACCCAAAAAATGCTAAGGG + Intergenic
1193895046 X:87103135-87103157 AGGCACATCTCAAATGCTCAAGG - Intergenic
1193895069 X:87103488-87103510 AGGCACATCTCAAATGCTCAAGG - Intergenic
1194370999 X:93071265-93071287 AATCATGTCCAAAATGATCAAGG + Intergenic
1194643977 X:96435753-96435775 AAGCAGCTACACAATGCTGAAGG + Intergenic
1195557191 X:106240663-106240685 AATCTATTCCAAAATGCTCACGG - Intergenic
1199651768 X:149951973-149951995 AACCACCTCCACAATGCTATGGG - Intergenic
1200678793 Y:6183154-6183176 AATCATGTCCAAAATGATCAAGG + Intergenic
1201852044 Y:18495790-18495812 AAGCACATCCAAATTGCTAGTGG + Intergenic
1201881277 Y:18824590-18824612 AAGCACATCCAAATTGCTAGTGG - Intronic