ID: 1091176177

View in Genome Browser
Species Human (GRCh38)
Location 11:133560028-133560050
Sequence TAGTTCATATGGAATCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091176173_1091176177 22 Left 1091176173 11:133559983-133560005 CCACTAATCTACTTTCCATCTCA No data
Right 1091176177 11:133560028-133560050 TAGTTCATATGGAATCATAATGG No data
1091176175_1091176177 7 Left 1091176175 11:133559998-133560020 CCATCTCAATACATTAGGCATAG No data
Right 1091176177 11:133560028-133560050 TAGTTCATATGGAATCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091176177 Original CRISPR TAGTTCATATGGAATCATAA TGG Intergenic
No off target data available for this crispr