ID: 1091190989

View in Genome Browser
Species Human (GRCh38)
Location 11:133695130-133695152
Sequence GCATCAGAGCTTCCCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091190986_1091190989 -6 Left 1091190986 11:133695113-133695135 CCACACAACTCGACACAGCATCA No data
Right 1091190989 11:133695130-133695152 GCATCAGAGCTTCCCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091190989 Original CRISPR GCATCAGAGCTTCCCTTGGA GGG Intergenic