ID: 1091192203

View in Genome Browser
Species Human (GRCh38)
Location 11:133705467-133705489
Sequence CACCCCAAGAGGTGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091192203_1091192211 8 Left 1091192203 11:133705467-133705489 CCCCACAGCCACCTCTTGGGGTG No data
Right 1091192211 11:133705498-133705520 ACAGCTTAGCCTGCTGAGCCTGG No data
1091192203_1091192212 9 Left 1091192203 11:133705467-133705489 CCCCACAGCCACCTCTTGGGGTG No data
Right 1091192212 11:133705499-133705521 CAGCTTAGCCTGCTGAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091192203 Original CRISPR CACCCCAAGAGGTGGCTGTG GGG (reversed) Intergenic
No off target data available for this crispr