ID: 1091194483

View in Genome Browser
Species Human (GRCh38)
Location 11:133719677-133719699
Sequence CGTGACCAGAACGAGGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091194483_1091194486 -8 Left 1091194483 11:133719677-133719699 CCAGCGACCTCGTTCTGGTCACG No data
Right 1091194486 11:133719692-133719714 TGGTCACGGTGCATCCACTGAGG No data
1091194483_1091194489 27 Left 1091194483 11:133719677-133719699 CCAGCGACCTCGTTCTGGTCACG No data
Right 1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG No data
1091194483_1091194492 29 Left 1091194483 11:133719677-133719699 CCAGCGACCTCGTTCTGGTCACG No data
Right 1091194492 11:133719729-133719751 CCTGATGCTCCTGCTCACAGGGG No data
1091194483_1091194490 28 Left 1091194483 11:133719677-133719699 CCAGCGACCTCGTTCTGGTCACG No data
Right 1091194490 11:133719728-133719750 ACCTGATGCTCCTGCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091194483 Original CRISPR CGTGACCAGAACGAGGTCGC TGG (reversed) Intergenic
No off target data available for this crispr