ID: 1091194485

View in Genome Browser
Species Human (GRCh38)
Location 11:133719684-133719706
Sequence GATGCACCGTGACCAGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091194485_1091194492 22 Left 1091194485 11:133719684-133719706 CCTCGTTCTGGTCACGGTGCATC No data
Right 1091194492 11:133719729-133719751 CCTGATGCTCCTGCTCACAGGGG No data
1091194485_1091194490 21 Left 1091194485 11:133719684-133719706 CCTCGTTCTGGTCACGGTGCATC No data
Right 1091194490 11:133719728-133719750 ACCTGATGCTCCTGCTCACAGGG No data
1091194485_1091194493 30 Left 1091194485 11:133719684-133719706 CCTCGTTCTGGTCACGGTGCATC No data
Right 1091194493 11:133719737-133719759 TCCTGCTCACAGGGGCGACGTGG No data
1091194485_1091194489 20 Left 1091194485 11:133719684-133719706 CCTCGTTCTGGTCACGGTGCATC No data
Right 1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091194485 Original CRISPR GATGCACCGTGACCAGAACG AGG (reversed) Intergenic
No off target data available for this crispr