ID: 1091194487

View in Genome Browser
Species Human (GRCh38)
Location 11:133719706-133719728
Sequence TCGGCAGTGTTGCTCCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091194487_1091194496 10 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194496 11:133719739-133719761 CTGCTCACAGGGGCGACGTGGGG No data
1091194487_1091194489 -2 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG No data
1091194487_1091194493 8 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194493 11:133719737-133719759 TCCTGCTCACAGGGGCGACGTGG No data
1091194487_1091194495 9 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194495 11:133719738-133719760 CCTGCTCACAGGGGCGACGTGGG No data
1091194487_1091194490 -1 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194490 11:133719728-133719750 ACCTGATGCTCCTGCTCACAGGG No data
1091194487_1091194497 19 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194497 11:133719748-133719770 GGGGCGACGTGGGGTGACAATGG No data
1091194487_1091194492 0 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194492 11:133719729-133719751 CCTGATGCTCCTGCTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091194487 Original CRISPR TCGGCAGTGTTGCTCCTCAG TGG (reversed) Intergenic
No off target data available for this crispr