ID: 1091194489

View in Genome Browser
Species Human (GRCh38)
Location 11:133719727-133719749
Sequence GACCTGATGCTCCTGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091194487_1091194489 -2 Left 1091194487 11:133719706-133719728 CCACTGAGGAGCAACACTGCCGA No data
Right 1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG No data
1091194483_1091194489 27 Left 1091194483 11:133719677-133719699 CCAGCGACCTCGTTCTGGTCACG No data
Right 1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG No data
1091194485_1091194489 20 Left 1091194485 11:133719684-133719706 CCTCGTTCTGGTCACGGTGCATC No data
Right 1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091194489 Original CRISPR GACCTGATGCTCCTGCTCAC AGG Intergenic
No off target data available for this crispr