ID: 1091194569

View in Genome Browser
Species Human (GRCh38)
Location 11:133720089-133720111
Sequence CTGGTAAGGAGGAGATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091194558_1091194569 15 Left 1091194558 11:133720051-133720073 CCCAGCACAAGTGAGTCAGGAAC No data
Right 1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG No data
1091194562_1091194569 -7 Left 1091194562 11:133720073-133720095 CCATCTCCCATTGGTCCTGGTAA No data
Right 1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG No data
1091194559_1091194569 14 Left 1091194559 11:133720052-133720074 CCAGCACAAGTGAGTCAGGAACC No data
Right 1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG No data
1091194556_1091194569 30 Left 1091194556 11:133720036-133720058 CCAGGCTTTCTCAAGCCCAGCAC No data
Right 1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091194569 Original CRISPR CTGGTAAGGAGGAGATTTGG AGG Intergenic
No off target data available for this crispr