ID: 1091198088

View in Genome Browser
Species Human (GRCh38)
Location 11:133748895-133748917
Sequence ATGTTAGGAGGTGGGGCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091198088_1091198096 9 Left 1091198088 11:133748895-133748917 CCAACGGCCCCACCTCCTAACAT No data
Right 1091198096 11:133748927-133748949 GACTTCAACATAGAAATTTTGGG No data
1091198088_1091198097 29 Left 1091198088 11:133748895-133748917 CCAACGGCCCCACCTCCTAACAT No data
Right 1091198097 11:133748947-133748969 GGGTGATTAGATTTCAACATAGG No data
1091198088_1091198095 8 Left 1091198088 11:133748895-133748917 CCAACGGCCCCACCTCCTAACAT No data
Right 1091198095 11:133748926-133748948 AGACTTCAACATAGAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091198088 Original CRISPR ATGTTAGGAGGTGGGGCCGT TGG (reversed) Intergenic