ID: 1091199207

View in Genome Browser
Species Human (GRCh38)
Location 11:133760001-133760023
Sequence GTGTTATTCTTTAGGACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091199207_1091199211 17 Left 1091199207 11:133760001-133760023 CCTTATGTCCTAAAGAATAACAC No data
Right 1091199211 11:133760041-133760063 GTATTCCTTTTGTCTCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091199207 Original CRISPR GTGTTATTCTTTAGGACATA AGG (reversed) Intergenic
No off target data available for this crispr