ID: 1091200807

View in Genome Browser
Species Human (GRCh38)
Location 11:133779174-133779196
Sequence AACATAACACTCCTGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091200805_1091200807 -9 Left 1091200805 11:133779160-133779182 CCATTTAAAATGGAAACATAACA No data
Right 1091200807 11:133779174-133779196 AACATAACACTCCTGTAGCAGGG No data
1091200802_1091200807 15 Left 1091200802 11:133779136-133779158 CCCATTAAAAAGTGTTCAAAAGC No data
Right 1091200807 11:133779174-133779196 AACATAACACTCCTGTAGCAGGG No data
1091200803_1091200807 14 Left 1091200803 11:133779137-133779159 CCATTAAAAAGTGTTCAAAAGCT No data
Right 1091200807 11:133779174-133779196 AACATAACACTCCTGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091200807 Original CRISPR AACATAACACTCCTGTAGCA GGG Intergenic
No off target data available for this crispr