ID: 1091203852

View in Genome Browser
Species Human (GRCh38)
Location 11:133804290-133804312
Sequence GGTGCCTGTGTGGGAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091203852_1091203861 2 Left 1091203852 11:133804290-133804312 CCTGCAACTCCCACACAGGCACC No data
Right 1091203861 11:133804315-133804337 AAGGAACACAAGGAAACTCGGGG No data
1091203852_1091203859 0 Left 1091203852 11:133804290-133804312 CCTGCAACTCCCACACAGGCACC No data
Right 1091203859 11:133804313-133804335 CAAAGGAACACAAGGAAACTCGG No data
1091203852_1091203860 1 Left 1091203852 11:133804290-133804312 CCTGCAACTCCCACACAGGCACC No data
Right 1091203860 11:133804314-133804336 AAAGGAACACAAGGAAACTCGGG No data
1091203852_1091203856 -8 Left 1091203852 11:133804290-133804312 CCTGCAACTCCCACACAGGCACC No data
Right 1091203856 11:133804305-133804327 CAGGCACCCAAAGGAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091203852 Original CRISPR GGTGCCTGTGTGGGAGTTGC AGG (reversed) Intergenic