ID: 1091204401

View in Genome Browser
Species Human (GRCh38)
Location 11:133809870-133809892
Sequence GGTACTATGGGATGACAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091204401_1091204411 29 Left 1091204401 11:133809870-133809892 CCCGCCTGTCATCCCATAGTACC No data
Right 1091204411 11:133809922-133809944 TCTTCCAAGAATTCCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091204401 Original CRISPR GGTACTATGGGATGACAGGC GGG (reversed) Intergenic
No off target data available for this crispr