ID: 1091204807

View in Genome Browser
Species Human (GRCh38)
Location 11:133812857-133812879
Sequence AAGTTGCCACAGATGAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091204804_1091204807 0 Left 1091204804 11:133812834-133812856 CCACAGCGAGTAGCCAAGAGGCC No data
Right 1091204807 11:133812857-133812879 AAGTTGCCACAGATGAAGTGAGG No data
1091204801_1091204807 19 Left 1091204801 11:133812815-133812837 CCAAAATGACCTTTGGTGACCAC No data
Right 1091204807 11:133812857-133812879 AAGTTGCCACAGATGAAGTGAGG No data
1091204799_1091204807 29 Left 1091204799 11:133812805-133812827 CCTGGATTTTCCAAAATGACCTT No data
Right 1091204807 11:133812857-133812879 AAGTTGCCACAGATGAAGTGAGG No data
1091204802_1091204807 10 Left 1091204802 11:133812824-133812846 CCTTTGGTGACCACAGCGAGTAG No data
Right 1091204807 11:133812857-133812879 AAGTTGCCACAGATGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091204807 Original CRISPR AAGTTGCCACAGATGAAGTG AGG Intergenic
No off target data available for this crispr