ID: 1091207663

View in Genome Browser
Species Human (GRCh38)
Location 11:133832767-133832789
Sequence CAGGGCAGGACTTCGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091207663_1091207681 20 Left 1091207663 11:133832767-133832789 CCGCCCCGCGAAGTCCTGCCCTG No data
Right 1091207681 11:133832810-133832832 CCCACCGGTTGGGGACCTTCGGG No data
1091207663_1091207684 26 Left 1091207663 11:133832767-133832789 CCGCCCCGCGAAGTCCTGCCCTG No data
Right 1091207684 11:133832816-133832838 GGTTGGGGACCTTCGGGCTGCGG No data
1091207663_1091207679 19 Left 1091207663 11:133832767-133832789 CCGCCCCGCGAAGTCCTGCCCTG No data
Right 1091207679 11:133832809-133832831 ACCCACCGGTTGGGGACCTTCGG No data
1091207663_1091207678 11 Left 1091207663 11:133832767-133832789 CCGCCCCGCGAAGTCCTGCCCTG No data
Right 1091207678 11:133832801-133832823 GCGATCAAACCCACCGGTTGGGG No data
1091207663_1091207676 9 Left 1091207663 11:133832767-133832789 CCGCCCCGCGAAGTCCTGCCCTG No data
Right 1091207676 11:133832799-133832821 CCGCGATCAAACCCACCGGTTGG No data
1091207663_1091207673 5 Left 1091207663 11:133832767-133832789 CCGCCCCGCGAAGTCCTGCCCTG No data
Right 1091207673 11:133832795-133832817 CCCACCGCGATCAAACCCACCGG No data
1091207663_1091207677 10 Left 1091207663 11:133832767-133832789 CCGCCCCGCGAAGTCCTGCCCTG No data
Right 1091207677 11:133832800-133832822 CGCGATCAAACCCACCGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091207663 Original CRISPR CAGGGCAGGACTTCGCGGGG CGG (reversed) Intergenic
No off target data available for this crispr