ID: 1091211366

View in Genome Browser
Species Human (GRCh38)
Location 11:133864159-133864181
Sequence CTGTGGGTCTGAGGGTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091211354_1091211366 14 Left 1091211354 11:133864122-133864144 CCCACCAGGCCCTGAGACGGGTC No data
Right 1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG No data
1091211359_1091211366 5 Left 1091211359 11:133864131-133864153 CCCTGAGACGGGTCTGAGGGTCT No data
Right 1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG No data
1091211360_1091211366 4 Left 1091211360 11:133864132-133864154 CCTGAGACGGGTCTGAGGGTCTA No data
Right 1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG No data
1091211350_1091211366 24 Left 1091211350 11:133864112-133864134 CCTCAGTTTCCCCACCAGGCCCT No data
Right 1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG No data
1091211356_1091211366 10 Left 1091211356 11:133864126-133864148 CCAGGCCCTGAGACGGGTCTGAG No data
Right 1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG No data
1091211353_1091211366 15 Left 1091211353 11:133864121-133864143 CCCCACCAGGCCCTGAGACGGGT No data
Right 1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG No data
1091211355_1091211366 13 Left 1091211355 11:133864123-133864145 CCACCAGGCCCTGAGACGGGTCT No data
Right 1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091211366 Original CRISPR CTGTGGGTCTGAGGGTCCTA GGG Intergenic
No off target data available for this crispr