ID: 1091213613

View in Genome Browser
Species Human (GRCh38)
Location 11:133885545-133885567
Sequence GAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091213613_1091213621 24 Left 1091213613 11:133885545-133885567 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091213613 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr