ID: 1091213621

View in Genome Browser
Species Human (GRCh38)
Location 11:133885592-133885614
Sequence CAGTCCTAATGAGATGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3380
Summary {0: 11, 1: 422, 2: 925, 3: 902, 4: 1120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091213618_1091213621 6 Left 1091213618 11:133885563-133885585 CCCTCTGTGGGCTACAACCACTG No data
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120
1091213614_1091213621 21 Left 1091213614 11:133885548-133885570 CCCTGCTTCTGCTTGCCCTCTGT 0: 39
1: 124
2: 357
3: 680
4: 1396
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120
1091213612_1091213621 25 Left 1091213612 11:133885544-133885566 CCCACCCTGCTTCTGCTTGCCCT 0: 75
1: 252
2: 589
3: 812
4: 1291
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120
1091213615_1091213621 20 Left 1091213615 11:133885549-133885571 CCTGCTTCTGCTTGCCCTCTGTG 0: 39
1: 114
2: 362
3: 691
4: 1471
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120
1091213619_1091213621 5 Left 1091213619 11:133885564-133885586 CCTCTGTGGGCTACAACCACTGT No data
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120
1091213611_1091213621 26 Left 1091213611 11:133885543-133885565 CCCCACCCTGCTTCTGCTTGCCC 0: 63
1: 240
2: 550
3: 1053
4: 2832
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120
1091213613_1091213621 24 Left 1091213613 11:133885545-133885567 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1091213621 11:133885592-133885614 CAGTCCTAATGAGATGAACCAGG 0: 11
1: 422
2: 925
3: 902
4: 1120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091213621 Original CRISPR CAGTCCTAATGAGATGAACC AGG Intergenic
Too many off-targets to display for this crispr