ID: 1091216708

View in Genome Browser
Species Human (GRCh38)
Location 11:133906767-133906789
Sequence CCCTGGGATGCACTGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091216708_1091216716 5 Left 1091216708 11:133906767-133906789 CCACATCCCAGTGCATCCCAGGG No data
Right 1091216716 11:133906795-133906817 CTGAGCCCCGTGAGCTCCTCTGG No data
1091216708_1091216717 6 Left 1091216708 11:133906767-133906789 CCACATCCCAGTGCATCCCAGGG No data
Right 1091216717 11:133906796-133906818 TGAGCCCCGTGAGCTCCTCTGGG No data
1091216708_1091216718 7 Left 1091216708 11:133906767-133906789 CCACATCCCAGTGCATCCCAGGG No data
Right 1091216718 11:133906797-133906819 GAGCCCCGTGAGCTCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091216708 Original CRISPR CCCTGGGATGCACTGGGATG TGG (reversed) Intergenic
No off target data available for this crispr