ID: 1091217052

View in Genome Browser
Species Human (GRCh38)
Location 11:133908521-133908543
Sequence CAGTGGAGGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1733
Summary {0: 1, 1: 3, 2: 19, 3: 190, 4: 1520}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217052 Original CRISPR CAGTGGAGGCAGGAGGAGGA GGG (reversed) Intergenic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900313098 1:2043859-2043881 CAGGGGAGGAAAGAGGAGGCTGG - Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900518426 1:3094259-3094281 CTGTGGAGGCAGGGTGGGGATGG - Intronic
900526521 1:3131864-3131886 CCCAGGAGGGAGGAGGAGGAAGG - Intronic
900602551 1:3509350-3509372 TAGTGGAGGCAGTAGGAGGGTGG - Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900702815 1:4058681-4058703 GCGTGGAGGGAGGAGGAGGAGGG + Intergenic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
901034327 1:6327228-6327250 CATAGGAGGCAGGAGCAGGCCGG - Intronic
901120013 1:6883505-6883527 CAGTGGAGGGAGGAGGCATAAGG + Intronic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901667445 1:10834866-10834888 CAGAGGAGGCTGGTGGCGGATGG + Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901840445 1:11950758-11950780 CATTGGACGTAGGTGGAGGAGGG - Intronic
901880216 1:12189342-12189364 CAGTGGAGGCAACAGGAAGCAGG - Intronic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
902436913 1:16404040-16404062 CTGTGGAGGCCAGAGGAGTAGGG + Intronic
902517166 1:16995810-16995832 CAGTGAGGGCAGGAGTGGGATGG + Intronic
902620824 1:17649896-17649918 CAGGCGAGGCAGGAGGAGAGAGG + Intronic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
902907183 1:19566903-19566925 CAGTGGAGGCAGGCAGCGGTGGG + Intergenic
903213958 1:21833033-21833055 CAGAGGAGCCACGAGGAGGCTGG + Intronic
903269564 1:22178795-22178817 CAGAGAAGGAAGGAGAAGGAAGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903455626 1:23484617-23484639 CAGAGGAGGGAGGAAGAGGGAGG - Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903760888 1:25698027-25698049 AAGTGAAGGCAGGAAGAGCAGGG - Intronic
903768174 1:25748039-25748061 AGGTGGAGGAAGGAGAAGGAAGG + Intronic
903935830 1:26894238-26894260 CAGTTCTGGCAGGAGGAAGAAGG - Exonic
903989188 1:27253408-27253430 GGGAGGAGGGAGGAGGAGGAGGG - Intronic
903989196 1:27253428-27253450 AGGAGGAGGAAGGAGGAGGAGGG - Intronic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904092658 1:27956093-27956115 CTGCGGAGGCCAGAGGAGGAGGG + Intronic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904612100 1:31731418-31731440 CACTGGGGGCAGGAGTGGGAGGG + Exonic
904648494 1:31986718-31986740 GAGTGGGTGCAGGAGGTGGAGGG - Intergenic
904828977 1:33294741-33294763 CAGTGGAGGCCAGAGAAGGAAGG + Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
904882260 1:33709870-33709892 CTGTGGATTCACGAGGAGGAGGG + Intronic
904948117 1:34214202-34214224 CATTCCAGGCAGGAGGAGCAAGG + Intronic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905118970 1:35667100-35667122 CAGAGGAGGCAAGAGGAAGAAGG - Intergenic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905212188 1:36381980-36382002 TCCTGGGGGCAGGAGGAGGATGG - Intronic
905356424 1:37388113-37388135 CAGTGCAGGTAGCATGAGGAGGG - Intergenic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905472521 1:38204289-38204311 CAGTTAAGGCAGGAGATGGAGGG + Intergenic
905474954 1:38219504-38219526 ATGTGCAGGCAGGAAGAGGAAGG + Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906000662 1:42421615-42421637 CTGTGGAGGCAGGACTAGGCGGG + Exonic
906130463 1:43452526-43452548 TACTGGAGGCAGGAGGCGGTGGG - Exonic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906509438 1:46402467-46402489 GGGTGGAGGCAGGAGGGAGAGGG - Intronic
906557425 1:46724734-46724756 GAGTGGAGGCATGGGCAGGAGGG - Intergenic
906564593 1:46789854-46789876 AAGTGGAGGCGTGTGGAGGATGG + Intronic
906747781 1:48233802-48233824 CAGTGGAGATTGGAGGAGGCTGG - Intronic
906782675 1:48586460-48586482 CAGGTGAGGAGGGAGGAGGAGGG + Intronic
907046254 1:51302088-51302110 CAGTGGAGGGAGGTGGAGGGAGG - Intronic
907213415 1:52842603-52842625 CTGGGGAGGCGGGAGGAGAACGG + Intronic
907275257 1:53313429-53313451 CTGTGGAGGACGGTGGAGGAAGG - Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907364316 1:53946409-53946431 CAGTGAAGGTGGGAGGAGGGAGG - Exonic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
907888926 1:58619768-58619790 AAGTGGAGACAGGAGAAGAAGGG + Intergenic
907911807 1:58833735-58833757 AAGTGGAGGCAGGAAGGGTAGGG + Intergenic
908322406 1:62991220-62991242 GAGAGGAGACAGGAGGAGGTGGG + Intergenic
908498836 1:64722675-64722697 CAGTGGAGCGAGCAGGAAGATGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908590664 1:65629624-65629646 GAATGGAGGGAGGAAGAGGAAGG - Intronic
908606440 1:65802248-65802270 CAGTGGAGTCAAAAGCAGGAAGG - Intronic
909458682 1:75882416-75882438 AAGTGGGGGGAGGAGGAAGAGGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
910000594 1:82336870-82336892 CAGTGGAGGAAGTAAGAGCATGG + Intergenic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
910332977 1:86097463-86097485 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
910332982 1:86097476-86097498 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911513057 1:98831640-98831662 CAGAGGAGGAGGGAGGAGTAGGG - Intergenic
912141261 1:106731097-106731119 TGGTGGAGGAAGGAGGTGGAGGG + Intergenic
912496440 1:110094943-110094965 CAGGAGGGGCAGGACGAGGATGG + Intergenic
912671246 1:111628300-111628322 CAGTGGCAGCAGGAGGGGAATGG + Intronic
912686640 1:111773098-111773120 CAGTGGAGGATGGAGGAAAAGGG + Intronic
912795768 1:112692714-112692736 GAGTGGGGGCAGGAACAGGATGG - Intronic
913072330 1:115310900-115310922 GAGTGGGAGGAGGAGGAGGAAGG + Intronic
913111177 1:115658656-115658678 CTGTGGGGGCAGGAGGCTGAGGG + Intronic
913199427 1:116484058-116484080 ATGTGGGGGCAGGAGGGGGAGGG + Intergenic
913565368 1:120068704-120068726 AGGTGGAGGCAGGAGAAGTAGGG - Intronic
913632763 1:120724858-120724880 AGGTGGAGGCAGGAGAAGTAGGG + Intergenic
913971792 1:143422301-143422323 CTGTGGAGGAAGGAGAAGAAGGG - Intergenic
914066171 1:144247914-144247936 CTGTGGAGGAAGGAGAAGAAGGG - Intergenic
914112982 1:144718440-144718462 CTGTGGAGGAAGGAGAAGAAGGG + Intergenic
914242517 1:145861285-145861307 CAGTAGTTGCAGGATGAGGAAGG + Intergenic
914285956 1:146228059-146228081 AGGTGGAGGCAGGAGAAGTAGGG - Intronic
914546988 1:148678812-148678834 AGGTGGAGGCAGGAGAAGTAGGG - Intronic
914619519 1:149391550-149391572 AGGTGGAGGCAGGAGAAGTAGGG + Intergenic
914920953 1:151847205-151847227 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920962 1:151847232-151847254 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920978 1:151847279-151847301 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
914920987 1:151847306-151847328 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
915234467 1:154470250-154470272 CACTGGAGCCAGGACGTGGAGGG + Intronic
915273417 1:154771909-154771931 CAGGGAAGGGAGGAGGAGTAGGG - Intronic
915275145 1:154783456-154783478 CACTGGCGGGAAGAGGAGGAAGG - Intronic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915440911 1:155944992-155945014 CAGTGGAGGATGGAGAAGGGAGG + Intergenic
915568919 1:156733356-156733378 CCCTGGAGTCACGAGGAGGATGG - Exonic
915624607 1:157106971-157106993 CAGTGGAGACAAGAGGAGAAGGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915719905 1:157977303-157977325 CACTGGGGGCGGGAGGGGGACGG + Intergenic
915965754 1:160306840-160306862 CAATGGAGGCAGCAGAAGGAGGG + Intronic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916176147 1:162040629-162040651 CAGTAGAGGAAGGAGTAGCATGG + Intergenic
916443097 1:164846713-164846735 CAGTTGGGGCAGGGGCAGGAGGG + Exonic
917202599 1:172533159-172533181 CAGTGGCGGCTGCAGGAGGCGGG + Exonic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
917533325 1:175856188-175856210 CTTTGGAGGCAGGTGGAGGCAGG + Intergenic
917903038 1:179562505-179562527 AAGTGGAGGGAGGATAAGGAAGG - Intronic
918617093 1:186557481-186557503 GAGTGGAGGGAGGAGGAGGGAGG - Intergenic
919176715 1:194028416-194028438 AGGGGGAGGAAGGAGGAGGAAGG - Intergenic
919333618 1:196204476-196204498 CAGTGGGGGCGGGAGGAGAGGGG - Intergenic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
919883847 1:201918491-201918513 GAGTGCAGGCAGGAAGGGGAGGG - Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920376828 1:205513277-205513299 CTCTGGAGGCAGGAGGATGGGGG + Intronic
920455794 1:206100140-206100162 CGGTGGAGGCAGGCAGAGGCAGG - Intronic
920671597 1:208007701-208007723 CAGGGGTGGAAGGACGAGGAAGG - Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921380284 1:214517629-214517651 AACAGGAGGCAGGAGGAGTAGGG + Intronic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921893993 1:220380055-220380077 AAGTGCAGGGAGGAGAAGGACGG - Intergenic
922060802 1:222089401-222089423 CAGTGGAGTGAGGAGGCTGAGGG + Intergenic
922113322 1:222584274-222584296 CATTGGAGGGAAAAGGAGGAAGG - Exonic
922173549 1:223177532-223177554 CAGTGGAGGCAGGTGTGGGCAGG - Intergenic
922722645 1:227906521-227906543 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922948658 1:229539133-229539155 AGGTGCAGGCAGGAGGAGGGCGG - Intronic
923138855 1:231142980-231143002 CAGTGCAGGATGGAGAAGGAGGG + Intergenic
923268469 1:232334589-232334611 GGGAGGAGGAAGGAGGAGGAAGG - Intergenic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
924852601 1:247845322-247845344 CAGTGGATCCAGGAAGAGGGAGG - Intergenic
1062782318 10:225447-225469 AAGCTGAGGCAGGAGGAGGCTGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062812525 10:477426-477448 GGGGGGAGGCAGGGGGAGGAAGG + Intronic
1062853991 10:770228-770250 CAGAGGAGGTCAGAGGAGGATGG + Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063159497 10:3408908-3408930 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063257099 10:4340467-4340489 AAAAGGAGGGAGGAGGAGGAAGG - Intergenic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063482338 10:6386644-6386666 CAGTGGAGGCTGGGTGAGGAAGG - Intergenic
1063494018 10:6490210-6490232 CAGTGGAGGCAGGAGGGGTTAGG - Intronic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1064015938 10:11772391-11772413 CACTGGTGTCAGCAGGAGGAGGG - Intergenic
1064211489 10:13363889-13363911 TAGTGGAGGCAGGACGGGGCGGG - Intergenic
1064288438 10:14012555-14012577 TAATGGAGGCAGCAGCAGGAGGG + Intronic
1064542016 10:16414814-16414836 CAGGGGAGGCGGGAGGTGGGGGG - Intergenic
1064750402 10:18522531-18522553 CAGGGGAGGCAAGGGTAGGAAGG + Intronic
1065318436 10:24486526-24486548 CAGTGAAGGAAGGAAGGGGAGGG - Intronic
1065325407 10:24546180-24546202 CGGAGGAGGCAGGAGAAGGAGGG - Exonic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066064230 10:31750555-31750577 CAGAGGAGGCTGGAGAAGCAGGG - Intergenic
1066752724 10:38675627-38675649 CAGTGCCGGCAGGAGTGGGATGG - Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067044205 10:42975281-42975303 CAGGGGAGGCTGGAGGGGGTGGG - Intergenic
1067344775 10:45429191-45429213 GAGATGAGGCAGGAGGAAGAGGG + Intronic
1068884381 10:62083500-62083522 GAGTGTGGGAAGGAGGAGGAGGG - Intronic
1069651429 10:70052810-70052832 TAGCGGGGGGAGGAGGAGGAGGG - Exonic
1069742250 10:70692254-70692276 CAGAAGAGCCAGGCGGAGGAGGG + Intronic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069777762 10:70936755-70936777 CAGAGGAGGAGGGTGGAGGATGG - Intergenic
1069878619 10:71578162-71578184 GAGTGAAGGCAGGAGGAACAGGG + Intronic
1069917282 10:71795545-71795567 GAGTGGAGGGCTGAGGAGGAGGG - Intronic
1069994807 10:72335698-72335720 CAGAGGAGGGAGGGGGAGAAAGG - Exonic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070314238 10:75295225-75295247 GAGGGGTGGCAGGAGGAGGCAGG + Intergenic
1070413921 10:76171475-76171497 CACAGGAGGTAGGAGGAGAAAGG - Intronic
1070997300 10:80796975-80796997 GAGTGGAGGGAGGATGAGGCTGG + Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071152233 10:82649245-82649267 AAGGGGAGGCAGGAGGTAGAGGG - Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071923119 10:90374043-90374065 CACTAGAGGAAGGTGGAGGAGGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072614530 10:97040493-97040515 GAATGCAGGCATGAGGAGGATGG + Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072904458 10:99439535-99439557 CAGGGGTGGGAGTAGGAGGAAGG + Intergenic
1072905646 10:99450924-99450946 CGGGGGAGGCAGGAGGAGCGGGG - Intergenic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1073152771 10:101323104-101323126 AAGTGGAGGCAGAGGGAGGTAGG + Intergenic
1073248899 10:102109869-102109891 GAGTGAAGGCAGGCGGGGGAAGG - Intronic
1073338391 10:102727621-102727643 CAGGGGAGGAAGGAAGAGGTAGG - Intronic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073424813 10:103449971-103449993 GAGAGGAGGCAGGAGGAGACGGG + Exonic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073665084 10:105522591-105522613 CAATGGAGGAAAGAGAAGGAGGG + Intergenic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1074059699 10:109953830-109953852 CAGTGCAGCCAGGAGTCGGAAGG - Exonic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1074847831 10:117414188-117414210 CAGTGGAGGAAAGAGGATTAGGG + Intergenic
1074885752 10:117691880-117691902 GAGTGGAGGAAGGAGGAAGCAGG - Intergenic
1074913729 10:117936212-117936234 GAGTGAAGGAAGGAGGACGAGGG - Intergenic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075058934 10:119241150-119241172 AAGCTGAGGCCGGAGGAGGAGGG - Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075529873 10:123220004-123220026 CAGCAGGGGCAGGAGGAGAATGG - Intergenic
1075688507 10:124380006-124380028 CAGGGGAGTCGGGAGGAGCAGGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076121404 10:127939798-127939820 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076121417 10:127939858-127939880 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076121429 10:127939918-127939940 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076413161 10:130265879-130265901 CAGAGGAGGGAGGTGGAGGGAGG + Intergenic
1076468662 10:130703342-130703364 CAGTTGATGCAGGTGGATGAGGG - Intergenic
1076549176 10:131267089-131267111 GAGTGGTGGCAGGAGGCAGACGG - Intronic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076733601 10:132449485-132449507 AGGTGGAGGAAGGAGGTGGAAGG + Intergenic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1076816735 10:132918793-132918815 CAGGGGATGCAGGAGGAGTTGGG - Intronic
1076818494 10:132926287-132926309 CCGTGGGGGCTGCAGGAGGAGGG + Intronic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1076917864 10:133433361-133433383 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1076937862 10:133577438-133577460 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1077015950 11:399305-399327 CAGAGGGGGCAGGTGGAGAAGGG - Intronic
1077015992 11:399409-399431 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077016021 11:399482-399504 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077052073 11:571494-571516 CAGGGGTGGCTGGAGGAGGTGGG - Intergenic
1077154955 11:1087138-1087160 CAGAGGAGGCCAGAGGAGGGAGG - Intergenic
1077154974 11:1087192-1087214 CAGAGGAGGCCAGAGGAGGGAGG - Intergenic
1077204556 11:1336363-1336385 CAGGGGAGGTGGGAGGAGGGAGG - Intergenic
1077283467 11:1755815-1755837 CGGAGGAGGCTGGAGGAGGGCGG - Intronic
1077307378 11:1874266-1874288 CAGTGGGGGCAGGCCGGGGACGG + Intronic
1077358047 11:2127682-2127704 CAGTGGGGACAGGAGCAGGAGGG + Intergenic
1077388592 11:2288222-2288244 CAGTGGAGGCAGGTGCAGAAAGG + Intergenic
1077483852 11:2829998-2830020 GGGAGGAGGAAGGAGGAGGAAGG + Intronic
1077483855 11:2830008-2830030 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1077502134 11:2914225-2914247 CAGTGGAGCCACGACCAGGAAGG - Intronic
1077557245 11:3231597-3231619 AACAGGAGGGAGGAGGAGGAGGG + Intronic
1077602395 11:3582458-3582480 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078101355 11:8332167-8332189 CAGTGGTGGCTGGAAAAGGAAGG + Intergenic
1078161510 11:8843715-8843737 CAGGGGTGGCATGAGCAGGATGG - Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078744303 11:14096574-14096596 CAGTGGAGGCTGCAGGTGGGTGG + Intronic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1079444183 11:20545063-20545085 TAGTGTGGGCAGGAAGAGGAGGG - Intergenic
1079445539 11:20553551-20553573 GGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1080875354 11:36269935-36269957 CACTGCAGGTTGGAGGAGGAGGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080925904 11:36755591-36755613 AAGTGGAGGCAGGTGGAAAAGGG - Intergenic
1081173445 11:39896129-39896151 GAGTAGAGGCAGGAGAAAGAGGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081775962 11:45676103-45676125 CAGTGGAGGAGGGAGGGGGTAGG - Intergenic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082932958 11:58628227-58628249 CAGTGGAGGTGGGATGAGGCAGG - Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083271850 11:61576734-61576756 CAGGAGGGGCAGGAGGGGGAGGG + Intronic
1083333750 11:61911299-61911321 CAAAGGTGGCAGGAGCAGGAGGG + Intronic
1083458990 11:62798674-62798696 GAGTGGAGGGATGAGCAGGATGG - Intronic
1083712785 11:64559342-64559364 CAGAGGAGGCAGGAGGGAGACGG - Intronic
1083800187 11:65041921-65041943 CAGTGGAGGTAGGGAAAGGAAGG + Intronic
1083857135 11:65398804-65398826 CGGAGGAGGCTGGAGCAGGACGG + Intronic
1084061069 11:66674987-66675009 CAGTGGAGACTGGGGAAGGAGGG - Intronic
1084258289 11:67957005-67957027 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084432970 11:69121822-69121844 GAGTGGAGGCAGCTGGCGGAGGG + Intergenic
1084645944 11:70457942-70457964 GGGTGGCGGGAGGAGGAGGATGG - Intergenic
1084743092 11:71151546-71151568 CAGTGCAGGCATGAGGGTGAAGG + Intronic
1084814457 11:71638205-71638227 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
1084864689 11:72046108-72046130 CACAGGAGGGAGGAAGAGGAGGG - Intronic
1084887506 11:72220809-72220831 ACGAGGTGGCAGGAGGAGGAGGG + Intronic
1084943544 11:72626868-72626890 CAGAGGAGGCTGCAGGAGGTTGG - Intronic
1084956791 11:72695864-72695886 CACTGGAGAGGGGAGGAGGAGGG + Exonic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1085243751 11:75080436-75080458 AGGTGGGGGCAGTAGGAGGAGGG - Intergenic
1085755540 11:79198472-79198494 GAGTGGTGGAAGGAGGGGGAAGG - Intronic
1085794722 11:79528559-79528581 GAGTGGAAGCTGGTGGAGGAAGG - Intergenic
1086302936 11:85448923-85448945 GAGTGGAAGGAAGAGGAGGAGGG - Intronic
1086861006 11:91924845-91924867 GAGTGAGGGCAGGAGGAGCAGGG + Intergenic
1086929925 11:92681835-92681857 CAGTGTGGGAGGGAGGAGGAGGG + Intronic
1086947798 11:92860466-92860488 GAGAGAAGGCAGGAGAAGGAGGG + Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087078583 11:94148864-94148886 CAATGGAGGGATGAGAAGGAAGG - Intronic
1087131801 11:94675155-94675177 CAGTGGAGGCCCAAGGGGGAGGG - Intergenic
1087142067 11:94774370-94774392 CACAGGAGGCAGGAGGAGGTGGG + Intronic
1087560620 11:99785043-99785065 AGGTGGAGGCAGGCGGAGGCAGG - Intronic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088520094 11:110688272-110688294 CATTGGGGGCGGGGGGAGGAGGG - Intronic
1088645476 11:111913320-111913342 GAGGGGAGTCAGGAGGAGTAGGG - Intronic
1088737011 11:112736113-112736135 CAAGGCAGGCAGGAGCAGGAGGG + Intergenic
1088906319 11:114157887-114157909 CAGTGGAGCCAGGGGCAGGGTGG - Intronic
1088938157 11:114425661-114425683 AAGTGGAGGCAAGAGTAGGAAGG - Intronic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089156357 11:116405911-116405933 CGGTGGAGGGAGGAGAAAGAAGG + Intergenic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1089905847 11:122037714-122037736 AAGAGGAGGAAGGAAGAGGAAGG + Intergenic
1089960944 11:122616891-122616913 AAATGCTGGCAGGAGGAGGAAGG - Intergenic
1090104792 11:123841270-123841292 CAGTGAGGTCAGGAGGATGAGGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090473944 11:127003399-127003421 CGGGGGAGGGAGGAGGAGGGAGG + Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1090777165 11:129975697-129975719 CAGTGGTGGCAGGAAGGGAATGG - Intronic
1090941783 11:131393584-131393606 TGGTGGGGGCAGTAGGAGGAGGG - Intronic
1091129626 11:133134522-133134544 CAGTGGAGGCAGGAGAGAAAGGG + Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091288099 11:134420111-134420133 CTGTGGAGGAAGGAGCTGGAGGG - Intergenic
1091304789 11:134530355-134530377 CAGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091310764 11:134573706-134573728 CAGAGGAGGCAGGAAGGGGATGG + Intergenic
1091325030 11:134679636-134679658 TGGAGGAGTCAGGAGGAGGAGGG + Intergenic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091788692 12:3258610-3258632 CCTTGGTGGGAGGAGGAGGAGGG - Intronic
1091963280 12:4717679-4717701 AGGCTGAGGCAGGAGGAGGATGG - Intronic
1092181746 12:6451213-6451235 CAGTGGGGGCAGGGGGAGACGGG - Intronic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092282613 12:7109071-7109093 CAGAGGAGGAGGGAAGAGGACGG - Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093016207 12:14156878-14156900 CAATGGAGGAAGGAGGGAGATGG + Intergenic
1093880306 12:24396565-24396587 GAGTGGAGGCAGGAGCTGGCAGG - Intergenic
1094488109 12:30940993-30941015 TGGTGGAGGTAGGGGGAGGATGG - Intronic
1095349041 12:41188330-41188352 CAGTGGAGGGAGGTGGCGGGTGG - Intergenic
1095426820 12:42083844-42083866 CAGTGGAGGTTGGAAGTGGAGGG - Exonic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096595009 12:52689471-52689493 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1096602092 12:52736576-52736598 CACCGGAGACAGGAGGAGCATGG - Intergenic
1096613867 12:52820593-52820615 TGATGGAGGCAGGAGTAGGACGG + Intergenic
1096630852 12:52925921-52925943 TAGGGGAGGAAGGAGGAGAAAGG + Intronic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1097282660 12:57854250-57854272 AAGGGGAGGAAGGAGGAAGAAGG + Intergenic
1097362491 12:58673154-58673176 TATTGGAGGCAGCAGGATGATGG - Intronic
1097790664 12:63811970-63811992 AAGAGGAGGAAGGAGGGGGAGGG + Intergenic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1097949700 12:65414014-65414036 TAGTTGAGGGAGGTGGAGGAGGG + Intronic
1097961183 12:65533395-65533417 CAGCAGAGACAGGAGGAGGGAGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1099023794 12:77440316-77440338 CATTAGAGCCAGGAGTAGGAAGG - Intergenic
1099064935 12:77963997-77964019 AAGAGGAGGGAGGAGGAGGGAGG - Intronic
1099437089 12:82658121-82658143 AAATGGAGGCTGCAGGAGGAAGG + Intergenic
1099740160 12:86624646-86624668 CAGTGGAGGAAGAAGGGGAAGGG + Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1101706532 12:107225735-107225757 AGGGGGAGGAAGGAGGAGGAGGG + Intergenic
1101719145 12:107335960-107335982 TTGTCGGGGCAGGAGGAGGAAGG - Intronic
1101750799 12:107581154-107581176 CAGCGGCGGCAGCACGAGGAAGG - Exonic
1101756880 12:107628042-107628064 AGGTGGAGGCAGGTGGAGGGTGG - Intronic
1101841311 12:108329269-108329291 CAGGGATGGCAGGAGGAGGTCGG - Intronic
1102101070 12:110279679-110279701 CACTGCAGGCAGGAGAAGGATGG - Intergenic
1102180498 12:110909109-110909131 CAGTGAAGGCAGGAGGACCCAGG - Intergenic
1102471716 12:113163202-113163224 CAGGGGAGCCAAGAGGCGGAGGG - Exonic
1102576642 12:113860096-113860118 CAGAGGAGGCACCAGGAGGGGGG - Intronic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102645830 12:114403275-114403297 AGGAGGAGGCAGGAGGAGGCGGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102679817 12:114683870-114683892 GAGCAGAGGAAGGAGGAGGAGGG - Intronic
1102712526 12:114940613-114940635 TGGTGGAGGGAGGAGGAGGGAGG - Intergenic
1102773584 12:115499597-115499619 CAGTGGAGGCAGCAGCAAGAGGG - Intergenic
1102798911 12:115714528-115714550 CAGAGGAGGCAGGAAGAGAAAGG + Intergenic
1102858212 12:116313291-116313313 TACTAGAGGCAGGAGGAGCAAGG - Intergenic
1103412466 12:120722172-120722194 ATGTGGAGGAAGGAGGAGGTGGG + Exonic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103907803 12:124336222-124336244 AAGTGGAGGCAGGCGGTGCAAGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1103989273 12:124787330-124787352 CATTTGAGGCAGGAGGCGGGGGG - Intronic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104466423 12:128994307-128994329 CACCTGAGACAGGAGGAGGAAGG + Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104733010 12:131119003-131119025 CAGTTGTGTCAGGAAGAGGATGG + Intronic
1104942817 12:132402899-132402921 CCGTGGAGGCAGGAGGGAGCAGG + Intergenic
1104964749 12:132503895-132503917 CAGTGGGGGCAGGAGGCTGAGGG - Intronic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105430688 13:20334550-20334572 CAGTGGTGGCAGTGGGAGGTGGG - Intergenic
1105602777 13:21901933-21901955 CAGCGGTGGCAGGAGCAGCATGG + Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106447671 13:29850666-29850688 CCGCGGAGGGAGGACGAGGACGG - Exonic
1106510469 13:30408505-30408527 AAATGGAGGCGCGAGGAGGAGGG + Intergenic
1106602424 13:31199725-31199747 CAGAGGAGAAAGGAAGAGGAGGG + Intergenic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1106883463 13:34157207-34157229 CAGAGGCGGCAGGAGGAGCTGGG - Intergenic
1107014482 13:35697229-35697251 CAGATGAGGAAAGAGGAGGAGGG - Intergenic
1107833768 13:44397344-44397366 CACTGGAGGCGGGAGGACAACGG + Exonic
1107906797 13:45068860-45068882 CTGAGGAGGCAGGAGATGGATGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1110388672 13:74945565-74945587 CAATGGAGGCAGGGAGGGGAGGG + Intergenic
1110388681 13:74945588-74945610 CAATGGAGGCAGGGAGGGGAGGG + Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110466077 13:75803432-75803454 CACAGGAGGCAGGAAGAGAAGGG + Intronic
1110929689 13:81199353-81199375 TGCTGGAGGCAGGGGGAGGAGGG - Intergenic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1112167385 13:96934055-96934077 TAGTGGAGGCAAGGGGAAGAAGG + Intergenic
1112323743 13:98429665-98429687 CAGCTGAGGCAGGAGGAAGTGGG + Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1113013114 13:105793461-105793483 CACTTGTGGCTGGAGGAGGAAGG + Intergenic
1113041025 13:106104001-106104023 GGGTGGAGGCAGGAGAATGAAGG - Intergenic
1113164989 13:107430438-107430460 GAGTGGAGGGAGCAGGGGGAGGG - Intronic
1113370037 13:109715911-109715933 CAGTGGGGGCAGAATGAGGGAGG - Intergenic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113433122 13:110267260-110267282 CAGTGGAGGGAGGAGGGGCAGGG + Intronic
1113447411 13:110379910-110379932 GAGAGGAGGCAGGTGGAGGAGGG - Intronic
1113618042 13:111694924-111694946 CAGTGGAGAGAGGAGAGGGAGGG - Intergenic
1113618055 13:111694983-111695005 CAGTGGAGAGAGGAGAGGGACGG - Intergenic
1113618465 13:111697239-111697261 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113618507 13:111697411-111697433 CTCTGGAGGCAGGGAGAGGAAGG - Intergenic
1113623575 13:111780185-111780207 CAGTGGAGAGAGGAGAGGGAGGG - Intergenic
1113623588 13:111780244-111780266 CAGTGGAGAGAGGAGAGGGACGG - Intergenic
1113623994 13:111782500-111782522 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113624036 13:111782672-111782694 CTCTGGAGGCAGGGAGAGGAAGG - Intergenic
1113674122 13:112196369-112196391 CTGAGGAGGCAGGAGCAGGGAGG - Intergenic
1113698267 13:112364339-112364361 AGGTGGAGGCAGGAGGAGCCTGG + Intergenic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113756107 13:112812304-112812326 CAGTGGGGGCAGGAAGGGGCCGG - Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114424567 14:22611363-22611385 AAGTGGGGGATGGAGGAGGAAGG - Exonic
1114525876 14:23366488-23366510 CAGCGGAGTCCGGAGGAGGAAGG - Intergenic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114870366 14:26648347-26648369 AAGTAAAGGCAGGAGGAAGAAGG + Intergenic
1115754681 14:36519362-36519384 CGGCGGCGGCTGGAGGAGGAAGG + Exonic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116769142 14:49106960-49106982 CAGTAGTGGTAGGAGGATGAAGG + Intergenic
1116770511 14:49122006-49122028 CAGTGGGGGCAGGAGATGGGGGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117340617 14:54788476-54788498 TGGTGCTGGCAGGAGGAGGAGGG - Intronic
1117442698 14:55774838-55774860 CAGTGGGGAGAGGATGAGGAGGG - Intergenic
1118635872 14:67748351-67748373 CACTGGAGGAAAGAGGTGGAGGG + Exonic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119067405 14:71542652-71542674 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
1119145576 14:72310745-72310767 CAGGGGAGGCTGGTGGTGGAAGG - Intronic
1119187629 14:72654102-72654124 CACTGTAGGAAGGAGGAGGCTGG - Intronic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1119229558 14:72969522-72969544 CCCAGGAGGCAGGAGGAGCAGGG + Exonic
1119320170 14:73725921-73725943 GGGTGGGGGCGGGAGGAGGAGGG - Intronic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119564526 14:75617072-75617094 CAGTGGATGGTGGAAGAGGATGG + Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119725978 14:76922134-76922156 CAGTAGAGGACGGTGGAGGATGG + Intergenic
1119726052 14:76922396-76922418 GAGTGGAGGATGGTGGAGGATGG + Intergenic
1119745374 14:77040144-77040166 TAACGGAGGGAGGAGGAGGAGGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119866611 14:77980081-77980103 AAGTGGGGGCTGGAGGAGAAAGG - Intergenic
1120167970 14:81220675-81220697 GAGCGGAGAGAGGAGGAGGAGGG + Exonic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1120723898 14:87916655-87916677 CAGTGGAGGAAGGAGCAGGCGGG + Intronic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120989550 14:90363071-90363093 CATTTGAGGCAGGAGGAGTGGGG + Intergenic
1121083067 14:91124330-91124352 AAGAGGAGGCATCAGGAGGAGGG - Intronic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121550484 14:94795970-94795992 AATTGGAGGAAGGAGAAGGAGGG + Intergenic
1121667829 14:95686261-95686283 GGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1121720933 14:96108263-96108285 CAGTGGAGGCAGGTGGGGACAGG - Intergenic
1121735710 14:96216685-96216707 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121843824 14:97156073-97156095 ATGTGGAGGCAAGAGGAGGGTGG + Intergenic
1122085328 14:99296996-99297018 GAGTGGAGAGAGGAAGAGGAGGG - Intergenic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122196539 14:100091574-100091596 CAAAGGATGCAGGAAGAGGATGG - Intronic
1122246130 14:100404768-100404790 GAATGCAGGCAGGAGGAGGGAGG - Intronic
1122248361 14:100420224-100420246 CAGTGGAGGGAAGTGGGGGAAGG - Intronic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122308520 14:100780372-100780394 CAGTGATGGAAGGAGCAGGAGGG - Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122842160 14:104471254-104471276 GGGTGGATGCAGGAAGAGGAGGG + Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1123043541 14:105500243-105500265 CAGAGGCTGCAGGTGGAGGAGGG - Intergenic
1123068110 14:105628256-105628278 GAGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123703735 15:22935617-22935639 TACTGGAGGCAGGAGGAGGAAGG + Intronic
1123808239 15:23897272-23897294 GTGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123871730 15:24581700-24581722 ATGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1123899558 15:24862913-24862935 ATGAGGAGGCAGGAGCAGGAAGG + Intronic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124430998 15:29608493-29608515 AGGAGGAGGCAGGAGGAGGCAGG - Intergenic
1124591585 15:31058669-31058691 CAGGAGAGGAAGGAGGAGTATGG + Intronic
1124612265 15:31216323-31216345 GAGCGGTGGGAGGAGGAGGAGGG + Intergenic
1124926852 15:34078363-34078385 CAATAGAGGTAGGAGGAGGGTGG + Intergenic
1125205378 15:37148623-37148645 AAATGGAGGCAGGAGGCAGAAGG - Intergenic
1125617824 15:41031489-41031511 GAGGGGAGGAAGGAGAAGGAAGG + Intronic
1125764338 15:42123251-42123273 GAGTGGGGGCAGGAAGAGGCAGG - Intergenic
1126096359 15:45093627-45093649 CATTTGAGGGAGGAGGAGGCTGG - Exonic
1126234959 15:46373028-46373050 CAGTAGAGGGAAGAGGAAGAGGG + Intergenic
1126280841 15:46947733-46947755 GAATGGAGGCAGGAAGAGGGTGG - Intergenic
1126376233 15:47999527-47999549 CAGTGGAGGCTGGATGGAGAAGG + Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126855464 15:52834660-52834682 AAGTGGGTGGAGGAGGAGGAGGG + Intergenic
1126928734 15:53622609-53622631 CAGTGGGGGCAGTCTGAGGAGGG + Intronic
1127479702 15:59367431-59367453 CAGTGGAGGAAGGAGTTGAAGGG + Intronic
1127568528 15:60216883-60216905 CATTAGAGGCAGGAAGAGGCAGG - Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128295608 15:66516337-66516359 TTTTGGAGGCAGGAGGAGGCTGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128582863 15:68820993-68821015 CAGTGGCGGCGGGGGGGGGAAGG + Intronic
1128701938 15:69811103-69811125 CAGAGGAGGCAGGGGAAGGAAGG - Intergenic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128744159 15:70101993-70102015 CAGTGGAGGCAGTAGAGGAAGGG - Intergenic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1128869813 15:71145836-71145858 GAGTGGAGGAAGGAGAGGGAAGG + Intronic
1129037955 15:72662320-72662342 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129211934 15:74074911-74074933 CACCTGAGGCAGGAGGTGGAAGG - Exonic
1129261909 15:74373417-74373439 TAGTGGGGGCAGGAGGGGAAGGG + Intergenic
1129306432 15:74667462-74667484 GGGTGGAGGGAGGAGGAGGGAGG + Intronic
1129383122 15:75180409-75180431 CAGTGGAGAGTGGAAGAGGAGGG + Intergenic
1129398469 15:75266173-75266195 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129402077 15:75290449-75290471 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129410417 15:75347781-75347803 CAGCGGGGGCATGGGGAGGACGG + Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1129609764 15:77043880-77043902 GTGTGGAGGCAGCAGGAGGGAGG + Exonic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129729060 15:77919225-77919247 CACCTGAGGCAGGAGGTGGAAGG - Intergenic
1129756123 15:78100325-78100347 CAATGGAGGTGGGAGGAGCACGG + Intronic
1129839477 15:78734882-78734904 CAGAAGAGGCTGGGGGAGGAGGG + Intergenic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1130898356 15:88188215-88188237 GAGTGGAGGGAGGAGAAAGAGGG + Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1131284696 15:91047719-91047741 CACAGGAGGAGGGAGGAGGAAGG - Intergenic
1131416658 15:92265855-92265877 AAGTGGGGGCAGGAGGGTGAAGG - Intergenic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1131666058 15:94572260-94572282 CAGTGGAGGCAGGTGGCACAGGG - Intergenic
1131760975 15:95622343-95622365 CAGTGGAGGCAGGCTGGGCATGG + Intergenic
1131854872 15:96582870-96582892 CAGTGCAGGCAGGAGCTGGTGGG - Intergenic
1131901091 15:97088616-97088638 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132012722 15:98290231-98290253 CAGTGGCTGGAGGAGGGGGAGGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132078637 15:98845505-98845527 GGGAGGAGGAAGGAGGAGGAGGG - Intronic
1132635304 16:942230-942252 CACTGGAGGCCAGAGGATGATGG - Intronic
1132640112 16:974358-974380 CCGAGGCGGGAGGAGGAGGAGGG + Intronic
1132897215 16:2234790-2234812 CGGTGGAGGTGGGAGGGGGAGGG + Intronic
1132989194 16:2784480-2784502 GAGAGGAGGCAGGAGGTGGTGGG + Exonic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133369681 16:5238556-5238578 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
1133392789 16:5422898-5422920 GAGGGGAGGAAAGAGGAGGAGGG + Intergenic
1133392821 16:5422994-5423016 GAGGGGAGGAAGGAGGAGAAAGG + Intergenic
1133490670 16:6264986-6265008 CATGGGAGGCAGGACGAGGTTGG - Intronic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133520231 16:6549388-6549410 CGAGGGAGGGAGGAGGAGGAGGG + Intronic
1133520246 16:6549425-6549447 GGGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1133817885 16:9212129-9212151 GGGTGGAGGGAGGAGGAGGGTGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134449392 16:14354212-14354234 AGGTAGAGGGAGGAGGAGGAAGG + Intergenic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134856860 16:17527301-17527323 AAATGGAGGATGGAGGAGGAAGG - Intergenic
1134948706 16:18342113-18342135 GAGAGGAGGGAGGGGGAGGAGGG + Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135221805 16:20620869-20620891 CAGTTGAGGAGGGAGGGGGAGGG + Intronic
1135255244 16:20936555-20936577 GACTAGAGGCAGGGGGAGGAGGG - Intronic
1135294115 16:21264494-21264516 GTGTGGGGGCAGGAGGAGGGAGG + Intronic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1135511289 16:23086093-23086115 CTTTGGAGGAAGGAGGAAGAAGG - Intronic
1135806958 16:25551432-25551454 TGGTGGAGGGAGGAGGAGGATGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136279316 16:29198743-29198765 CATTGGAGGCAGGACCAGCACGG + Intergenic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136539882 16:30923461-30923483 TGGTGGAGGAAGGAGGGGGAAGG + Intronic
1136550269 16:30979247-30979269 GGGTGGGGGCAGGAGGGGGATGG - Exonic
1136994161 16:35176776-35176798 CAGTGGAGGCAGGCAGATGCCGG - Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137592303 16:49700937-49700959 CAGAGGAGGGAGGAGAAGGGAGG + Intronic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137636637 16:49992671-49992693 AAGTGGAGGCAGGTGGATAACGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138126162 16:54440461-54440483 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138444616 16:57055522-57055544 AAGTTGAGGGAGGAGGAGGAAGG + Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138564919 16:57826073-57826095 CAGAGGAGGGAGGCAGAGGACGG - Intronic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1139301116 16:65946187-65946209 CAGGTGAGGGATGAGGAGGAAGG - Intergenic
1139330325 16:66183570-66183592 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139330328 16:66183580-66183602 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139424995 16:66873873-66873895 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1139425047 16:66874020-66874042 GGGAGGAGGGAGGAGGAGGAAGG - Intergenic
1139425061 16:66874053-66874075 TAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1139515691 16:67451188-67451210 CAGTGGAGGTAGGGGGAGAGCGG + Intronic
1139782360 16:69362337-69362359 CACTGCAGGCAGGAGGAGAAAGG - Intronic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140372511 16:74420945-74420967 AGGAGGAGGAAGGAGGAGGAAGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140433133 16:74921946-74921968 CAGTGGAGGAAGCAGAAGGAAGG - Exonic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1140874409 16:79137711-79137733 GAGTGGGGGCAGGAAGGGGATGG - Intronic
1141082117 16:81061707-81061729 CAGGGGAGGCAGAACTAGGAGGG + Exonic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141183553 16:81771187-81771209 CCTTGGAGGCAGCAGAAGGAAGG - Intronic
1141279018 16:82613935-82613957 CAGTGGTGGCAAGAGGACGTTGG + Intergenic
1141294175 16:82751393-82751415 GTGAGGAGGCAGGAGGAGGTGGG - Intronic
1141372476 16:83500559-83500581 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141610261 16:85177164-85177186 CCCTGGAAGCAGGAGGGGGAAGG + Intronic
1141643980 16:85357601-85357623 CAGAGCAGCCGGGAGGAGGACGG + Exonic
1141695926 16:85619411-85619433 GAGTGGAGGCGGGAGGGGGGTGG + Intronic
1141703628 16:85653308-85653330 AAGTGGGAGGAGGAGGAGGAGGG - Intronic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141735493 16:85849606-85849628 CAGTAGAGGCAAGAGGTGCAGGG - Intergenic
1141740991 16:85892865-85892887 CAGTGAAGGCTGGAGTAGGAAGG + Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141775798 16:86121880-86121902 AGGAGGAGGCAGGAGTAGGAGGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141964768 16:87434444-87434466 CAGCGAAGGCTGGTGGAGGAAGG - Intronic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142196817 16:88742805-88742827 CAGTGGGGGCTGCAGGTGGATGG + Intronic
1142228702 16:88889391-88889413 CAGAGGAGGCAGGGGCGGGAGGG + Intronic
1142251468 16:88993834-88993856 GGGAGGAGGGAGGAGGAGGAAGG - Intergenic
1142266504 16:89066406-89066428 CAGTGGAGTCAAGAGGGGGACGG + Intergenic
1142284865 16:89167593-89167615 CAGTGGAGGCGGGTGGGGGAAGG - Intergenic
1142286906 16:89175202-89175224 CGGTGGAGGCAGCTGGAGGTTGG + Intronic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1202996407 16_KI270728v1_random:115910-115932 CAGTGCCGGCAGGAGTGGGATGG - Intergenic
1203023094 16_KI270728v1_random:428252-428274 CAGTGCCGGCAGGAGTGGGATGG - Intergenic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142610972 17:1109113-1109135 CAGCGGCGGCGGGAGGAGGGAGG + Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1142899609 17:3003989-3004011 TAATGCAGGCTGGAGGAGGAGGG + Intronic
1143034348 17:3985927-3985949 CAGTGGAGGCTGGGGTAGGGAGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143120854 17:4605848-4605870 CAGAGGAGGCAGGGGGCGCAGGG + Intronic
1143462503 17:7112827-7112849 CCATGGAGGCAGGAGGAGCAGGG - Intronic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1143584586 17:7844844-7844866 CAGCGGTGGCCGGGGGAGGAGGG - Intronic
1143586476 17:7853172-7853194 CAGTGCAGTCAGGGGGAGGGAGG - Intronic
1143621641 17:8084325-8084347 GAGCTGAGGCAGGTGGAGGAGGG - Intronic
1143739567 17:8942387-8942409 CAGTGGGGGCAGGAGCTGCAAGG - Intronic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1143891778 17:10107701-10107723 CAGTGGTGGCAGGCTGAGCAGGG + Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144518857 17:15941029-15941051 CAGTTGAGGCAGGATGAGAGGGG + Intergenic
1144702323 17:17347751-17347773 CATTGAAGACAGGCGGAGGAAGG + Intergenic
1144709125 17:17388754-17388776 CAGAGGAGGAAGGAGAGGGATGG - Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144772045 17:17765325-17765347 CAGTCCAGGCAGGAGGTGGAGGG + Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144797614 17:17903016-17903038 CAGATGAGGCAGGTGGATGAAGG - Intronic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146640940 17:34541146-34541168 TAGTGGGGGCAGGAGAAGGCAGG - Intergenic
1146692111 17:34883731-34883753 CAGTGGAGGCAGGAGGTTTCCGG - Intergenic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1146741258 17:35285736-35285758 CAGAGCAGGCTGGAGAAGGATGG - Intergenic
1146762539 17:35490999-35491021 CTGGGGAGGCCGGAGGAGAAAGG - Intronic
1146825492 17:36019029-36019051 CAGTGGAGGCACTGAGAGGATGG - Intergenic
1147143099 17:38470014-38470036 GGGTGCAGGGAGGAGGAGGAAGG - Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1147860206 17:43516052-43516074 CAGTGGAGGTAGTAGGATGGTGG - Intronic
1147955734 17:44133298-44133320 CAGAGGAGTCAGGGGAAGGAGGG - Intergenic
1148108670 17:45132540-45132562 CGGAGGAGGCAGCAGGAGGTGGG + Intronic
1148322409 17:46765540-46765562 CAGTGCAGGCAGGAGAGAGAAGG - Intronic
1148343788 17:46890122-46890144 AAGAGGAGCGAGGAGGAGGAGGG - Intergenic
1148449108 17:47763054-47763076 CAGCTGAGGCAGGAGAAGGTGGG - Intergenic
1148455333 17:47808238-47808260 GGGTGGAGGCAGGAGGAGTGAGG + Exonic
1148559362 17:48597203-48597225 CAGAGGAGGGAGGAGGAATAAGG - Intronic
1148617555 17:49012641-49012663 GGGAGGAGGGAGGAGGAGGAGGG - Intronic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148673781 17:49433059-49433081 CAGTGGAGGGAGTAGTAGAATGG - Intronic
1148992094 17:51675136-51675158 CCATGGAGGCAGCCGGAGGAGGG + Intronic
1149183680 17:53972187-53972209 CAATGGAGGGAGTAAGAGGAGGG + Intergenic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150980198 17:70132765-70132787 CAGTGAAGGGAGGATGACGATGG + Exonic
1151393080 17:73801087-73801109 CACTGGAGGTGGGAGGAGGCTGG + Intergenic
1151499835 17:74481593-74481615 GGGTGGAGGCAGGAAGGGGAAGG + Intronic
1151726350 17:75887053-75887075 AGGCTGAGGCAGGAGGAGGAAGG + Intronic
1151784443 17:76268506-76268528 TAGTGGAGGGAGGAGGGGAAAGG + Intronic
1151852195 17:76697656-76697678 AGGTGGAGGCGGGAGGGGGAAGG + Intronic
1151919173 17:77140959-77140981 CCGGGGAGGCGGGAGGGGGAAGG - Intronic
1152000082 17:77639908-77639930 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152189380 17:78879232-78879254 CAGTGGTGGACAGAGGAGGAGGG + Intronic
1152320794 17:79608091-79608113 CAGAGGAGGGAGGGCGAGGAGGG + Intergenic
1152336879 17:79703703-79703725 GAGAGGGGTCAGGAGGAGGAAGG + Intergenic
1152382066 17:79947229-79947251 GAGTGCAGACAGGAAGAGGAGGG - Intronic
1152573581 17:81130780-81130802 CAGGGGAGGCTGGAGGCCGAGGG + Intronic
1152598375 17:81249257-81249279 AGGAGGAGGGAGGAGGAGGAAGG + Intronic
1152629592 17:81404541-81404563 CCCAGGAGGCTGGAGGAGGATGG + Intronic
1152642152 17:81453803-81453825 GAGTGAGGGCAGGAGGTGGAAGG - Intronic
1152681451 17:81670456-81670478 GAGTGGAGGCGGGAGGGGGAGGG + Intronic
1152818857 17:82425359-82425381 CAGAGGAGGCTGGAGAAGGCTGG + Intronic
1152913208 17:83017193-83017215 CAGTGGCGGGAGGAGGAAGGGGG + Intronic
1152970647 18:158425-158447 GAGAGGAGGGAGGAGGGGGAAGG - Intronic
1153448265 18:5197265-5197287 CAGCGGCGGCGGGAGGAGGAGGG + Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1154290448 18:13101997-13102019 GGGTGGAGGCAGGAGGAGCTAGG - Intronic
1154356441 18:13625747-13625769 GGGTGGTGGCAGGGGGAGGAGGG - Intronic
1155066551 18:22273804-22273826 GGGAGGAGGAAGGAGGAGGATGG - Intergenic
1155066572 18:22273863-22273885 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066581 18:22273889-22273911 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1155066589 18:22273915-22273937 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1155066597 18:22273938-22273960 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066606 18:22273964-22273986 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066611 18:22273977-22273999 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066620 18:22274003-22274025 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155096031 18:22557448-22557470 AATTGGGGGCAGGAGGGGGATGG + Intergenic
1155208390 18:23580279-23580301 TAGGGGAGGCAGGAGGACAAGGG - Intronic
1155345548 18:24853324-24853346 CAGTGATGGCAGGTGGGGGAGGG + Intergenic
1155517384 18:26637214-26637236 CGATAGAGTCAGGAGGAGGAAGG - Intronic
1156502537 18:37568594-37568616 GGGTGGTGGCAGGAAGAGGAGGG - Intergenic
1156520843 18:37721298-37721320 CACTGAAGGCAGGTGGAGGGAGG - Intergenic
1156750369 18:40446232-40446254 TGGTGGTGGCAGCAGGAGGAAGG + Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157126458 18:44960815-44960837 GGGTGGAGGGTGGAGGAGGAAGG - Intronic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157529371 18:48408930-48408952 CGGAGGAGGCGGGAGGAGGGAGG - Intronic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157555400 18:48610101-48610123 CAATGGAAGCAGGTGTAGGATGG + Intronic
1157619469 18:49007970-49007992 CTTTGGAGGCAGTAGGAGAATGG + Intergenic
1157689415 18:49668841-49668863 GGGTGGAGGGAGGAGGGGGAAGG + Intergenic
1157768650 18:50325088-50325110 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768653 18:50325098-50325120 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768656 18:50325108-50325130 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768659 18:50325118-50325140 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768662 18:50325128-50325150 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157881081 18:51321637-51321659 CTGTGGAGGCAGCAGAAGGTGGG + Intergenic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158036177 18:53033406-53033428 CAGTGAAGGAATGAGGAGAAAGG - Intronic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158516900 18:58138334-58138356 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158516907 18:58138352-58138374 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158516914 18:58138370-58138392 GAGGGGAGGAAAGAGGAGGAGGG - Intronic
1158602233 18:58864532-58864554 AAGTGGGGGAAGGAGAAGGAGGG + Intronic
1158850929 18:61495511-61495533 CCCAGGAGGCAGGAGGAGGGAGG + Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159232017 18:65620377-65620399 CAGTGGTGGCATGGGGAGGACGG + Intergenic
1159864056 18:73683698-73683720 CAGTGGAGGCAGGGGTCTGAGGG - Intergenic
1159950337 18:74478298-74478320 AGGTGGGGGCAGGAGCAGGAAGG - Intergenic
1160042328 18:75357139-75357161 CAGTCGTGGCAGAAGGATGAAGG - Intergenic
1160049009 18:75414472-75414494 CAGAGGAGGAAGGAAGAGGGAGG + Intronic
1160083400 18:75752761-75752783 GAGCAGAGGCTGGAGGAGGAGGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160448577 18:78946825-78946847 GAGAGGAGGAAGGAGGAGAAGGG + Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160672812 19:374214-374236 CAGTGGGGACAGGAGGAGCCCGG + Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160968449 19:1756922-1756944 GAGAGGAGGCAGGAGGTGGTGGG - Intronic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161030716 19:2056662-2056684 GAGAGGAGGAAGGATGAGGAGGG - Intergenic
1161151313 19:2711529-2711551 GAGTGGAGGGAGGAGAGGGAAGG - Intergenic
1161207121 19:3047059-3047081 AAGTGGAGGGAGGGGGAGGGAGG - Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161590936 19:5128844-5128866 CAGTGGAGGCGGGGGGCGGGGGG + Intronic
1161644677 19:5445726-5445748 CAGAGGAGGAGGGAGGAGGGAGG + Intergenic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1161678200 19:5665089-5665111 AAATGCTGGCAGGAGGAGGAAGG - Intronic
1161988097 19:7668936-7668958 CAGTAAGGGCTGGAGGAGGAAGG - Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162094519 19:8302624-8302646 CAGAGGAGTAAGGAGGGGGAAGG + Intronic
1162339208 19:10081742-10081764 AGGAGGAGGGAGGAGGAGGAAGG + Intergenic
1162364206 19:10238122-10238144 CAGTGGAGGCCCAGGGAGGATGG - Intergenic
1162856913 19:13475763-13475785 CAATGGAGGCAGGGGGCAGAAGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163111907 19:15166439-15166461 CAGTGGGTGCAGGAGTATGAAGG - Intronic
1163153028 19:15425829-15425851 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1163221169 19:15922252-15922274 GAATGTAGGGAGGAGGAGGATGG + Intronic
1163384650 19:16992129-16992151 CAGGGGAGGCAAGAACAGGAGGG - Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1163535051 19:17872227-17872249 CCGAGGAGGCAGGACGGGGAGGG - Exonic
1163575025 19:18105859-18105881 CAGTGGGGGCGTGGGGAGGACGG - Intronic
1163579686 19:18130916-18130938 CCCTGGAGGCAAGAGGAGGGTGG + Intronic
1163621479 19:18363447-18363469 CAGTGGGGGCACGTGGACGAAGG - Exonic
1163625288 19:18386068-18386090 CTCTGCAGGCAGGGGGAGGAGGG + Intronic
1163647119 19:18495750-18495772 CAGTGGAGGGATGGGGAGGCAGG + Intronic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1163821818 19:19500330-19500352 CAGTCCAGGCAGGAGAGGGAAGG + Intronic
1164636045 19:29792232-29792254 CAGTGGAGGCAGGCCCAGAAGGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1165164244 19:33840338-33840360 CAGTAAAGGCAGGAGGTGAAAGG + Intergenic
1165416022 19:35694062-35694084 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1165490694 19:36121226-36121248 CGGAGGAGGGCGGAGGAGGAAGG + Intronic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165747422 19:38238252-38238274 CAGAGGAGGCAGGAGGTGAGAGG + Intergenic
1165761407 19:38323450-38323472 CACTTGAGGCAGGAGGAAGCGGG + Intronic
1165928812 19:39343031-39343053 TTCTGGAGACAGGAGGAGGACGG - Intronic
1166197692 19:41217833-41217855 CAGTAGAGGCAGGAGAAGGCAGG + Intergenic
1166404634 19:42511280-42511302 TAATAGAGGCAGGAGGCGGAAGG + Intronic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1166753761 19:45178311-45178333 CAATGGAAGCCGGAGTAGGAGGG - Intronic
1166759519 19:45215891-45215913 CAGCGGCGGCAGGAGAAGGAGGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167253844 19:48415610-48415632 CAGTGGAGGCGGGGCTAGGAGGG + Intronic
1167291937 19:48629355-48629377 CAGCGGAGGCAGCAGGTGGTCGG - Exonic
1167322739 19:48806527-48806549 TAGTGGAGGCTGGAGGAGGCTGG + Exonic
1167381394 19:49140236-49140258 CAAGGTAGGCGGGAGGAGGAGGG + Intronic
1167645485 19:50703123-50703145 CTCTGGAGGGAGGATGAGGAAGG - Intronic
1167686513 19:50960052-50960074 GAGAGGAGGGGGGAGGAGGAGGG + Intronic
1167693493 19:51001288-51001310 CTCTGGAGGAAGGAGGAGGCTGG + Intronic
1167761494 19:51452668-51452690 CAGTGGGGCCAGGATGAGGCAGG + Intronic
1167777146 19:51565709-51565731 GGGAGGAGGCAGGATGAGGAAGG - Intergenic
1168109919 19:54186589-54186611 CAGTGGTGGCAGGAGTAGGTTGG - Intronic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168288159 19:55344662-55344684 CTGTGGTGGCAGGAGCAGGGAGG + Intronic
1168294264 19:55370879-55370901 AGGTGGAGGCAGGAGGAAGAGGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168514980 19:57003629-57003651 CAGGGGCTGCAAGAGGAGGAGGG - Intergenic
924985099 2:263906-263928 CGGTGGTGGGAGGAGGAGGACGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925144662 2:1572891-1572913 TATTGGAGGTCGGAGGAGGATGG + Intergenic
925237724 2:2293764-2293786 CAGAGGAGCCGGGAGGAGGGAGG - Intronic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
925286526 2:2719841-2719863 CGCTGGAGACATGAGGAGGAAGG + Intergenic
925339722 2:3127769-3127791 CAGTGGAGGGTGGAGGACGGAGG + Intergenic
925370794 2:3343963-3343985 GCGCTGAGGCAGGAGGAGGATGG + Intronic
925377539 2:3398961-3398983 CAGGGGAGGTGGGAGGGGGAGGG - Intronic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925732430 2:6928883-6928905 CAGAAGTGGCAGGAAGAGGATGG - Intronic
925909932 2:8567178-8567200 AGGTGGGGGCAGGTGGAGGAAGG - Intergenic
925926662 2:8676144-8676166 CAGCGGAGGCAGGAAGAGGCCGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926266792 2:11330740-11330762 GGGAGGAGGGAGGAGGAGGAGGG + Intronic
926266797 2:11330753-11330775 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
926590474 2:14735047-14735069 CATTCCAGGCAGGAGGAAGAGGG - Intergenic
926942529 2:18153554-18153576 CAGAGGAGGAAGGAGAAGAAAGG + Intronic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
928979060 2:37119429-37119451 TAGAGGAGGCAGGAGGAACAGGG + Intronic
929092565 2:38233983-38234005 CAGTGGAGGGAGGCTGGGGAGGG - Intergenic
929426771 2:41851813-41851835 CACTGGAGGTGGGAGGAGGTGGG + Intergenic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929671258 2:43877736-43877758 CAGTGGGCTCATGAGGAGGATGG - Intronic
929936778 2:46298896-46298918 GGGTGGAGACAGGAGGAGAAAGG - Intronic
931430147 2:62202851-62202873 GAAGGGAGGTAGGAGGAGGAGGG - Intronic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932056885 2:68454629-68454651 CACTGGAGGAAGGTGGAGGTAGG - Intergenic
932467110 2:71931012-71931034 AAGAGAAGGCAGGAGGAGAAAGG + Intergenic
932539411 2:72636425-72636447 AAGAGGAGGGAGGAGGAAGAAGG + Intronic
932593723 2:73081563-73081585 CAGTGGGAGCAGGAGTGGGAGGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933158740 2:79001650-79001672 CAGAGGAGGAAGTAAGAGGAGGG + Intergenic
933180631 2:79222643-79222665 AAAAGAAGGCAGGAGGAGGAAGG - Intronic
933779324 2:85790638-85790660 TAGTGGAGGCATGAGTAGGCAGG + Intergenic
933995827 2:87669065-87669087 TGGTAGAGGCAGGAGGAGGCAGG + Intergenic
934117706 2:88812236-88812258 CAAGGGAGGCAGGAGGAGTCAGG - Intergenic
934176482 2:89583233-89583255 CTGTGGAGGAAGGAGAAGAAGGG - Intergenic
934186296 2:89679449-89679471 CAGTGCCGGCAGGAGTGGGATGG + Intergenic
934286792 2:91657594-91657616 CTGTGGAGGAAGGAGAAGAAGGG - Intergenic
934315712 2:91917781-91917803 CAGTGCTGGCAGGAGTGGGATGG - Intergenic
934564337 2:95330126-95330148 GAGAAGAGGCAGGAGCAGGAAGG + Intronic
934704116 2:96464374-96464396 CACTGGTGGCAGGAGGAGGCAGG - Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934740129 2:96714403-96714425 CAGTGGTGTTAAGAGGAGGACGG - Intronic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
934976350 2:98805555-98805577 CTCTGGAGGGTGGAGGAGGAGGG - Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935469646 2:103442965-103442987 CACTAAAGGCTGGAGGAGGAAGG + Intergenic
935558543 2:104537441-104537463 GATTGCAGGCAGGAGGAGGGTGG - Intergenic
935679617 2:105624691-105624713 GAGAGGTGGCAGCAGGAGGAGGG - Intergenic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936161373 2:110086302-110086324 CAAGGGAGGCAGGAGGAGCCAGG - Intronic
936183290 2:110285052-110285074 CAAGGGAGGCAGGAGGAGCCAGG + Intergenic
936298030 2:111281847-111281869 TGGTAGAGGCAGGAGGAGGCAGG - Intergenic
936523527 2:113227378-113227400 GAGTGGGGGCAGGAGGAAGTGGG - Intronic
936881416 2:117255760-117255782 CATTTGAGTCAGGAGGAAGAAGG + Intergenic
937025357 2:118692982-118693004 GAGCGGGGGCAGGAGAAGGAAGG + Intergenic
937098144 2:119248931-119248953 CAGTGGAGGCTGGAGGCAGTGGG + Intronic
937152324 2:119694583-119694605 CAAAGGGGCCAGGAGGAGGATGG - Intergenic
937217349 2:120321220-120321242 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
937273684 2:120671023-120671045 CTCTGGGGGCAGGGGGAGGAGGG + Intergenic
937358676 2:121214065-121214087 CAGGGGAGGTCAGAGGAGGAGGG - Intergenic
937930921 2:127204754-127204776 CAGTGAAGGCAGGACGCTGAGGG + Intronic
937941446 2:127289301-127289323 CAGTGAAGGAACCAGGAGGAAGG + Intronic
937984576 2:127632798-127632820 CAGAGGAGGCAGGAGGGGTGGGG - Intronic
938093528 2:128447915-128447937 CAGTGGGGGCAGGTGGGGGGCGG + Intergenic
938093568 2:128448027-128448049 CAGTGGGGGCAGGTGGGGGGCGG + Intergenic
938093595 2:128448101-128448123 CAGTGGGGGCAGGTGGTGGGCGG + Intergenic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938579412 2:132633016-132633038 CAGTGGAGGCAGCAGTGGGGAGG - Intronic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
939385458 2:141490891-141490913 AAGTGGAGGGAGGGGGACGAAGG - Intronic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
940182088 2:150946044-150946066 CAGTGGAGGTAGGTGGGGTAAGG - Intergenic
940205347 2:151195946-151195968 CAGTGTAGGCAGGAAGCAGAGGG - Intergenic
940533466 2:154908403-154908425 CAGTGGAGGCAGGTAGCTGAGGG + Intergenic
940954443 2:159712460-159712482 AAGTGGGGGGAGGAGGAGCAGGG + Intronic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941894150 2:170612649-170612671 CAGTGGAGGCAGGAGTTAGAGGG + Intronic
942524806 2:176841798-176841820 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
942612253 2:177754577-177754599 CAGGGGAGGAAGGTGAAGGAAGG - Intronic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
942829418 2:180222147-180222169 CAGTGGATGGAGGAGAAGAATGG - Intergenic
943011200 2:182451796-182451818 CCGTGGAGGCAGTAGGAGAGAGG - Intronic
944768934 2:202893804-202893826 AAATTGAGGGAGGAGGAGGAAGG - Intronic
944770809 2:202912475-202912497 AGGAGGAGGCAGGAGGAAGACGG - Intronic
944832790 2:203549586-203549608 GAGTGGAGGCAAGAGAAGGAGGG - Intergenic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945256315 2:207806345-207806367 GAGTGGTGGCAGGAAGATGAGGG + Intergenic
945972341 2:216243103-216243125 CTCTGGAGGCATGTGGAGGAGGG - Intergenic
945976317 2:216273889-216273911 GGGTGGAGGCAGGAGGTGGTGGG + Intronic
946115179 2:217455163-217455185 TAGTGGTGGCAGGAGCAGGGAGG + Intronic
946239787 2:218346486-218346508 CAGACAAGGCAGGAGGAGCAGGG - Exonic
946388887 2:219403824-219403846 AAATGGAGGCACAAGGAGGAAGG + Intergenic
946688512 2:222294300-222294322 CACTGGGGGCGGGAGGAGGAAGG + Exonic
946784243 2:223225697-223225719 CAGTGGTGGGAGGAGGGGCAGGG + Intergenic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947347534 2:229208775-229208797 CGGAGGAGGCAGGAGGAGAAAGG + Intronic
947542808 2:230990444-230990466 CTCTGGAAGCAGGATGAGGACGG + Intergenic
947790779 2:232867653-232867675 CTGGGGAGGCAGGACGAGGCAGG - Intronic
947817458 2:233047798-233047820 AGGAGGAGGCGGGAGGAGGATGG + Intergenic
948091926 2:235302165-235302187 AAGGGGAGGAGGGAGGAGGAGGG - Intergenic
948091955 2:235302235-235302257 AAGAGGAGGGAGGAGGAAGAGGG - Intergenic
948166345 2:235865588-235865610 CAGTGGAGGGAGTTGGGGGAGGG - Intronic
948229268 2:236337618-236337640 CAGTGGAGCGAGGAGGAGCCTGG - Intronic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948402485 2:237693703-237693725 CATAGATGGCAGGAGGAGGATGG + Intronic
948577792 2:238965453-238965475 CGGTGGAGGCAGGAGGGAGGAGG - Intergenic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948737522 2:240018940-240018962 TGGTGGGGGCAGGAGCAGGATGG - Intronic
948860553 2:240750728-240750750 CACAGGAGACAGGAGGTGGAGGG + Intronic
948895885 2:240926613-240926635 AGGTGGAGGCAGGAGCCGGAGGG + Intronic
948962958 2:241355368-241355390 CGTTGGAGGAAGGAGGAGGCTGG + Intergenic
1168828838 20:833478-833500 CGCGGGAGGGAGGAGGAGGAAGG + Intergenic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169081405 20:2799661-2799683 TAGAGGAGGCAAGTGGAGGAGGG - Intronic
1169190432 20:3655563-3655585 CACTGGAAGCTGGAGGAGGTAGG - Intergenic
1169210868 20:3765707-3765729 AGGGGGAGGCAGGAGGAGGGAGG - Intronic
1169211672 20:3769155-3769177 CGGAGGAGGCAGGAGGGGGAAGG - Intergenic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169334295 20:4742679-4742701 GAGAGGAGGCAAGAGGAGGGAGG - Intergenic
1169837666 20:9898560-9898582 CAATGGAGGCAGGAGGCAGTGGG + Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170206360 20:13802861-13802883 TAGTGGAGGGAGGAAGAAGAGGG - Intronic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170408968 20:16067886-16067908 GAGTGGAGGGGGGAAGAGGATGG - Intergenic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170562467 20:17569576-17569598 TAGTTGGGGGAGGAGGAGGATGG - Intergenic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172151943 20:32796896-32796918 TAGAGGAGGCAAGGGGAGGAAGG - Intronic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1173119410 20:40275195-40275217 TCCTGGAGGGAGGAGGAGGAAGG + Intergenic
1173801916 20:45899437-45899459 GAGTGGGGGCAGGATGGGGAAGG - Intronic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1173941347 20:46913795-46913817 CAGTGGAGGGAGGAGCAGGTTGG + Intronic
1174043192 20:47714543-47714565 AGGTGGAGGCAGGAGGACCAGGG - Intronic
1174112463 20:48205895-48205917 CAGAGAAGGAGGGAGGAGGAGGG - Intergenic
1174168773 20:48603624-48603646 CAGAGAAGGAGGGAGGAGGAGGG + Intergenic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1174641771 20:52050472-52050494 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1174781640 20:53394898-53394920 CAGTGGAGGCTGCATGTGGAGGG - Intronic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175348740 20:58302604-58302626 GAGTTGGGGCAGGCGGAGGAAGG - Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175776936 20:61659561-61659583 GCTTGGAGGCAGGAGGAGGGTGG + Intronic
1175776947 20:61659600-61659622 GCTTGGAGGCAGGAGGAGGGTGG + Intronic
1175776968 20:61659678-61659700 GCTTGGAGGCAGGAGGAGGGTGG + Intronic
1175776980 20:61659717-61659739 GCTTGGAGGCAGGAGGAGGGTGG + Intronic
1175879310 20:62247582-62247604 AGGAGGAGGCAGGAGGAGGCAGG + Intronic
1175970691 20:62685234-62685256 GTGTGGGGGCAGGAGGAGGGGGG + Intronic
1176047643 20:63101064-63101086 CCGTGCAGGCAGCAGCAGGAAGG - Intergenic
1176057166 20:63154903-63154925 GGGAGGAGGGAGGAGGAGGAAGG - Intergenic
1176160386 20:63644609-63644631 CACAGCAGGCAGGAGAAGGATGG - Intronic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1176234020 20:64045841-64045863 CGGTGGAGGCGGGGGGAGGGGGG - Intronic
1176943696 21:14954009-14954031 GAGTGGAGGCAAGAGAAGGCGGG - Intergenic
1177690511 21:24500254-24500276 CACTTGACCCAGGAGGAGGAGGG + Intergenic
1177758288 21:25373643-25373665 GAGTGGGAGGAGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177948264 21:27500567-27500589 CAGTGGTGGCAGGGTGGGGAGGG + Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178301548 21:31457790-31457812 CCCTGGAGGCAGGAGGTGGGGGG - Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178514064 21:33230756-33230778 GCGTGGAGGCAGGAGGGGGAAGG + Intronic
1178515024 21:33239306-33239328 CAGTGCAGGCAGGAAGCTGAGGG - Intronic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178627055 21:34227146-34227168 CATCGGAGGCAGGAGGGAGAGGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178832842 21:36070729-36070751 CATTGGGGGAAGGAGGATGAAGG - Intronic
1178951978 21:36992789-36992811 GAGTGGAGGTGGGAGAAGGATGG - Intergenic
1179025183 21:37673817-37673839 CAGTGGAGGAAAGAAGGGGAAGG + Intronic
1179179283 21:39031606-39031628 CAGTGGAGGTAGGAGGTGCCGGG - Intergenic
1179346627 21:40564473-40564495 AAGTAGAGGAAGGAGGAGGGTGG - Intronic
1179536255 21:42054700-42054722 CAGAGGTGGCAGTAAGAGGATGG + Intergenic
1179614171 21:42571011-42571033 CAGTGGAGCCTGGAGGAGTCAGG - Intronic
1179826524 21:43969097-43969119 CTCTGGAGGGAGGAGAAGGAGGG - Exonic
1179964849 21:44796934-44796956 CAGTGAAGGCAGGATGGGGGTGG - Intronic
1180172970 21:46070066-46070088 CCGTGGAGGCTGGCGGAGCACGG + Intergenic
1180175191 21:46083846-46083868 CAGAGCAGGCAGGAGTGGGAGGG + Intergenic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1180841869 22:18962714-18962736 CAGTGGTGGCAAGGAGAGGACGG + Intergenic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181059631 22:20276150-20276172 CAGTGGTGGCAAGGAGAGGATGG - Intronic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181318816 22:21989096-21989118 AAGTGGGTGCAGCAGGAGGAAGG + Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181547421 22:23609969-23609991 CAGTGAAGGCATGAGGGGCAGGG - Intronic
1181886083 22:26023504-26023526 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1182007670 22:26974838-26974860 CAGTGGAGGGAGGGGTGGGAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182566910 22:31206862-31206884 CAAGGGTGGCAGGAGGAGGGTGG - Exonic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182847467 22:33443412-33443434 CAGTGCAGACAGGAGCAGGTGGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182961434 22:34479075-34479097 GAGTGGAGGAAGGAGGAAGAGGG - Intergenic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183261360 22:36797871-36797893 CGTGGGAGGCAGGAGGAAGAGGG + Intergenic
1183354933 22:37353161-37353183 GACTGGATGCAAGAGGAGGAAGG - Intergenic
1183404464 22:37623674-37623696 AGGTGGGGGCAGGAGGTGGAGGG - Intronic
1183442266 22:37830026-37830048 GAGGGGAGGCAGGGGCAGGAGGG - Intergenic
1183465383 22:37977803-37977825 CAGTGGAGACAGGAGATGGCTGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183956579 22:41383811-41383833 CAAAGGAGGCAGGAGAAGGCAGG - Intronic
1183982427 22:41549466-41549488 GAGCGGAGGCAGGACCAGGAAGG + Intergenic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184291899 22:43501825-43501847 AAGATGAGGGAGGAGGAGGAGGG - Intronic
1184375827 22:44112027-44112049 GAGTGGAAGCAGGCAGAGGAGGG + Intronic
1184515199 22:44957457-44957479 CTCTGGAGGCAGCATGAGGACGG - Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184656904 22:45946472-45946494 CGGTGGGGGCAGGAGAACGAAGG - Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184889956 22:47373606-47373628 GCGTGGAGCCAGGAGGAGAAGGG + Intergenic
1184895285 22:47403075-47403097 CAGAGGAGGCAGGAGGGGTGCGG + Intergenic
1185191376 22:49438623-49438645 CAGTGGAGGGAGGAGGGGGTTGG + Intronic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
949470516 3:4391090-4391112 CAGTGGAGACCAGAGGATGATGG - Intronic
949518351 3:4827179-4827201 CTGTCGGGGCAGGAGCAGGAGGG - Intronic
949872032 3:8597021-8597043 CAGTGGAGGGAGAAGGGGCAAGG - Intergenic
949953046 3:9245292-9245314 CAGTGCAGGCAGTAGAAGGGTGG - Intronic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950235807 3:11319383-11319405 AAGTGCTGGTAGGAGGAGGAGGG - Intronic
950276118 3:11662563-11662585 TAGTGGAGGCAGTGGGAGAAGGG - Intronic
950346687 3:12301727-12301749 GTGTGGTGGCAGGAGGAGAATGG - Intronic
950362892 3:12462373-12462395 CGGTGGTGGCAGGGAGAGGAGGG - Intergenic
950426708 3:12928246-12928268 CGGTGGAGGTAGGAGCAAGAAGG + Intronic
950469337 3:13174838-13174860 CAGTGGTGGGAGGAGGTGGGGGG - Intergenic
950528232 3:13537025-13537047 CAGTGGAGGAAGCAGGAGTCGGG + Intergenic
950589726 3:13928412-13928434 TTGTGGAGGGCGGAGGAGGATGG - Intergenic
950627971 3:14262227-14262249 GACAGGAGGCAGGAGGAAGAAGG - Intergenic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
952169501 3:30791422-30791444 AAGTGGAGGCAGGCTCAGGAAGG - Intronic
952735749 3:36690113-36690135 CAATAGAGGCAGGGGGAAGAGGG + Intergenic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
953853127 3:46480980-46481002 CAGTGGAGGAGGGTGGAGGCTGG - Intronic
953855835 3:46498617-46498639 CGGGGGAGGCCGGAGGAGCAGGG + Intronic
953862010 3:46552572-46552594 GAAAGAAGGCAGGAGGAGGATGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954443113 3:50532570-50532592 CAGCTGAGCCAGGAGGAGAAAGG + Intergenic
954534681 3:51350686-51350708 CACTGGAGGCAGAAGTTGGAAGG - Intronic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954654309 3:52184677-52184699 CAGAGGAGGCAGGCAGAGGGAGG + Intergenic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
954876456 3:53805930-53805952 AAGATGAGGGAGGAGGAGGAGGG - Intronic
955024566 3:55155125-55155147 AAGTGGTGGCATGAGGAAGATGG + Intergenic
955059551 3:55483680-55483702 CAGAGGAGTGAGGTGGAGGAGGG + Intronic
955589160 3:60515323-60515345 ATGTGGTGGGAGGAGGAGGAAGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
955892366 3:63663647-63663669 GAGAGGGGGCAAGAGGAGGAGGG - Intronic
955953995 3:64269234-64269256 TAGTGGTGGCAGGCGGAGGAGGG + Intronic
956201787 3:66713971-66713993 CAGTGGGGAAATGAGGAGGATGG - Intergenic
956492285 3:69785892-69785914 CCGTGGATGAAGGAGGAAGAGGG + Intronic
956617783 3:71190175-71190197 CTATGGAGGCAGTAGGAAGATGG - Intronic
956657967 3:71570443-71570465 GAGTGGAGGCTGAAAGAGGATGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957071380 3:75570397-75570419 CAGGGGTGGCAGGAGGAAAAGGG + Intergenic
957073245 3:75581524-75581546 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
957430634 3:80101172-80101194 CATTGTAGGCAGGAGGAAGAAGG + Intergenic
958048653 3:88317838-88317860 CAGTGGGGGCTGTAGGATGAGGG + Intergenic
958843627 3:99239067-99239089 GAGTGGGGGGAGGGGGAGGATGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
959370229 3:105514731-105514753 AAGTGGTGGGGGGAGGAGGAAGG + Intronic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
961036316 3:123644424-123644446 CAGGGGAGGCATGGGGTGGAGGG + Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961122628 3:124385678-124385700 AAGTGGAGAAAGGAGAAGGAAGG + Intronic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961456031 3:127024440-127024462 CAGTGGAGGGAGGGAGAGGGAGG + Intronic
961485783 3:127214952-127214974 CAATGGAGGCTGGAGGGAGACGG + Intergenic
961523786 3:127483824-127483846 AAGAGGAGGGAGGAGGAAGAGGG + Intergenic
961873553 3:130004330-130004352 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
961940938 3:130636896-130636918 GAGGGGAGGAAGGGGGAGGAAGG - Intronic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962494434 3:135924900-135924922 CAGTTAAGGCAGGAGGAGAAAGG - Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
962948990 3:140200800-140200822 AAGAGGAGGCAGGTGGGGGAGGG - Intronic
963039168 3:141056087-141056109 CATTGGAGCCAGGAGGAGGCAGG + Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963156886 3:142108838-142108860 CCCTTGAGGCAGGAGGAGCACGG - Intronic
963373604 3:144434689-144434711 CACTTGGGACAGGAGGAGGAGGG + Intergenic
963427084 3:145144242-145144264 CAATGGAGGTAGGAGGAAGGGGG + Intergenic
963517462 3:146326421-146326443 CAGAGGAGGAATGAGGATGAAGG + Intergenic
963748754 3:149152473-149152495 CAGTGGAGGTAGGAGGGGGAAGG + Intronic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
964276080 3:155010461-155010483 CAGTGAAGGAAGGGTGAGGAAGG - Intergenic
964720586 3:159764650-159764672 GAGTGGGCGCCGGAGGAGGACGG + Exonic
965165652 3:165192787-165192809 CAGTAGAGGAGGGAGGAGAAGGG + Intronic
965527617 3:169738201-169738223 TAGTGGGGGCAGGGGGAGGTTGG + Intergenic
965817733 3:172654106-172654128 AAATGGAGGCAAGAGGAGCATGG + Intronic
965953869 3:174344512-174344534 CAGGGGAGGCTGGAGAGGGATGG - Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966594191 3:181711767-181711789 CGGGGGAGGCCGGGGGAGGAGGG - Intergenic
966683385 3:182667433-182667455 CAGTAGCGGCAGTAGGTGGAGGG - Intergenic
966695279 3:182783750-182783772 CAGAGGGGGCAAGAGGAGGAAGG + Intergenic
967021286 3:185525129-185525151 CACTCGAGCTAGGAGGAGGAGGG + Intronic
967316517 3:188155527-188155549 GAGTTGAGGAAGGGGGAGGATGG - Intronic
967880336 3:194297217-194297239 CGGAGGGGGCAGGAGGGGGAGGG - Intergenic
967934405 3:194715377-194715399 GAGTGAAGGAAGGAGGAGGAAGG - Intergenic
967982471 3:195074027-195074049 GAGTGGTGGGAGGAGGAGGTGGG - Intronic
967987687 3:195107517-195107539 AGGAGGAGGAAGGAGGAGGAGGG + Intronic
968005906 3:195242633-195242655 CATGGGAGGCTGGAGGAGGTGGG + Intronic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968710680 4:2114558-2114580 CAGTGGAGGCCAGAAGATGATGG - Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969533382 4:7741493-7741515 GGGAGGAGGGAGGAGGAGGAAGG - Exonic
969583385 4:8078289-8078311 CAGTGCAGGAAAGAGCAGGAGGG + Intronic
969598344 4:8161453-8161475 GAGCTGAGGCTGGAGGAGGAGGG - Intergenic
969671037 4:8590568-8590590 CAGGTGAGGCAGGAGGGCGAGGG - Intronic
969737119 4:8999496-8999518 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
969796311 4:9531084-9531106 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
970444209 4:16110295-16110317 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
970619296 4:17800831-17800853 AAGTGGAGGTGGGAGGAGGTAGG - Exonic
971141764 4:23932327-23932349 CCCTGGAGGCAGGAGGAGGATGG - Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971574525 4:28256554-28256576 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574530 4:28256567-28256589 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574535 4:28256580-28256602 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574547 4:28256612-28256634 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574552 4:28256625-28256647 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
972123254 4:35732110-35732132 GAATGGAGGCAGGAGAAGGATGG + Intergenic
972710334 4:41588935-41588957 CAGTGGAGGCAAGAGATGGCTGG + Intronic
972813744 4:42620664-42620686 AAGAGGAGGCAGGAGGGGTACGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
975307518 4:72866629-72866651 CAGTGGATGCAGCACAAGGAGGG + Intergenic
975470198 4:74757085-74757107 CTGTGGAGCCAGGAGGACCATGG + Intronic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
975778589 4:77817726-77817748 AAGTGGAGGGAAGAGAAGGAGGG - Intronic
976873367 4:89823603-89823625 CAGTGGAGGAGAGTGGAGGATGG + Intronic
977019947 4:91746594-91746616 CAGTGGAGGTAGCAGGGGGTGGG + Intergenic
977635590 4:99294064-99294086 CAGTGGAGGTAGCAGGAGAGTGG - Intergenic
978351590 4:107825266-107825288 CGGAGGGGCCAGGAGGAGGATGG + Intronic
978777283 4:112516395-112516417 GGGTGGTGGGAGGAGGAGGATGG - Intergenic
979558251 4:122075542-122075564 CAAGGGTGGCAGGAGGAGGGTGG + Intergenic
979700244 4:123658744-123658766 CAGAGGGGGAAGGATGAGGAGGG + Intergenic
979828167 4:125266037-125266059 CAGTGGCGGCAGCAGCAGGTGGG + Intergenic
981033730 4:140151182-140151204 GAGTGGCTGGAGGAGGAGGAAGG + Intronic
981054368 4:140345044-140345066 CAGTGGAGGAAAGAGCAAGAGGG + Intronic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
982064861 4:151645208-151645230 CCATGGAGACAGTAGGAGGAGGG + Intronic
982074396 4:151724261-151724283 AACTGAAGGCAAGAGGAGGAGGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
985011633 4:185588593-185588615 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985117468 4:186605654-186605676 AGGTGGAGGGAGGAGGAGTAGGG + Intronic
985566476 5:620870-620892 CCGGGGAGGCAGGAGGCAGATGG - Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985646908 5:1089225-1089247 CCGTGGGGGCAGGAGGGGGCAGG + Intronic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
985795900 5:1961971-1961993 CAGTGGAGGCCTGGTGAGGAGGG - Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG + Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986235387 5:5904916-5904938 AAATGGAGGGAAGAGGAGGAAGG + Intergenic
986353882 5:6905464-6905486 CACTGGAGACAGGTGGAGAATGG - Intergenic
986494061 5:8323785-8323807 CAGGGGAGGAAGTAGAAGGAAGG + Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986790251 5:11152718-11152740 CAGTGGAGTGAGGAGGAGTAAGG - Intronic
987049373 5:14136555-14136577 GGGTGGTGGCAGGAGGAGGGAGG + Intergenic
987616169 5:20276939-20276961 AAGGGGAGGAAGGAGTAGGAAGG + Intronic
989210434 5:38853926-38853948 CTGTGGAGCCTTGAGGAGGAAGG + Intronic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990528959 5:56655052-56655074 CAGTGGGGGAAAGAGGAGAAGGG - Intergenic
990616219 5:57511204-57511226 GAGTGGTGAAAGGAGGAGGAAGG + Intergenic
991667597 5:69014674-69014696 CAGTGGGGGCAGGAAAAGGGAGG - Intergenic
991952508 5:71960273-71960295 CAGTGGTGGCTGCATGAGGATGG - Intergenic
991956258 5:71998398-71998420 CAGCAGAGGCTGGTGGAGGAAGG + Intergenic
991958039 5:72015144-72015166 CAGTGCAGGCAGGAACAAGAAGG + Intergenic
992222117 5:74583387-74583409 CATAGGATGCAGGAAGAGGAAGG - Intergenic
992406457 5:76462065-76462087 AAGTTGAGGCACTAGGAGGAAGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995402343 5:111757281-111757303 AAGAGGAGGGAGGAGGGGGAAGG + Intronic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996521971 5:124437243-124437265 CACTGGAGGCAGGAGGCTGATGG + Intergenic
997459174 5:134040613-134040635 CTGTGGAGGCAGGCTGAGGCAGG + Intergenic
997606576 5:135179313-135179335 CAGAGGAGCCAGGAGGGGGCTGG + Intronic
997756353 5:136403162-136403184 GAGGGGAGGCTGGAGGTGGATGG + Intergenic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
997801239 5:136864762-136864784 CAGTGGAGGGAGGAGGCTGATGG + Intergenic
997882921 5:137606301-137606323 CACTGCAGTCAGGAGGAGGATGG + Intergenic
997972939 5:138419166-138419188 CAGTGCAGGGCGGAGGAGGGTGG - Exonic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998215840 5:140238165-140238187 AAAAGGAGGCAGGAGGAGTAGGG + Intronic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
999370447 5:151052111-151052133 GAGTGGGGGCTGCAGGAGGAGGG - Intronic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
1000550634 5:162658459-162658481 CAGTGGAGGGAGCAGGTGGGAGG + Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001132891 5:169079491-169079513 GGGGGGAGGGAGGAGGAGGAAGG + Intronic
1001132989 5:169079816-169079838 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001315096 5:170636345-170636367 CAGTGGAGGCAGGAGGCAGAAGG + Intronic
1001404955 5:171469732-171469754 CAAGGGAGGGGGGAGGAGGAGGG - Intergenic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1001732652 5:173971908-173971930 GTGTGGAGGCAGCAGGGGGAGGG + Intergenic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002393655 5:178936611-178936633 GTTTGGAGGCTGGAGGAGGATGG - Intergenic
1002432059 5:179209369-179209391 CAGTGGAGGTGCGAGGCGGAGGG + Intronic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002660606 5:180788947-180788969 CGGTGGAGCCAGGAGGAGTTTGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002936971 6:1682353-1682375 CAGTGGAGGCCTGAGGAGGCGGG - Intronic
1003113989 6:3271255-3271277 AAGTGGAGGCAGGGAGAGGCTGG + Exonic
1003187861 6:3848964-3848986 CATCAGAGGCGGGAGGAGGAGGG + Intergenic
1003454662 6:6270708-6270730 CTGTGGAGGAAGGTGGAGAATGG + Intronic
1003602102 6:7526984-7527006 CCATGGAGGCTGGAGGGGGAAGG - Intergenic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1004757943 6:18633605-18633627 GAGGGGAGGGAGTAGGAGGAGGG + Intergenic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083646 6:21981668-21981690 CAGAGCAGGAAGGAGGAGGTAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005428156 6:25725824-25725846 CAGTGGAGGTTGGAGCGGGAGGG - Intergenic
1005471179 6:26164166-26164188 CAGTGGTAGCAGGAGGTGGCAGG + Intronic
1005768985 6:29045837-29045859 GAGTGGGGGCAGGAGATGGATGG + Intergenic
1005816087 6:29553908-29553930 CAGCGGAGGCCGGAGGAGGGCGG + Intergenic
1005826064 6:29632581-29632603 CGAGGGAGGCAGGAGGAGGGTGG - Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005989222 6:30892920-30892942 CAGTGGGGGCTGGGGGAGCAGGG - Intronic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006185026 6:32176641-32176663 CAGAGAAGGCAGGTGGAGGGGGG - Exonic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006371973 6:33650424-33650446 CGGAGGAGTCAGGAGGAGCAGGG + Intronic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006520627 6:34568997-34569019 TAGTGGAAGCAGGAACAGGACGG + Intergenic
1006582861 6:35086788-35086810 CCCTGGGGGCAGGCGGAGGAGGG - Intronic
1006613609 6:35310447-35310469 CCCTGGTGGCAGGTGGAGGAGGG + Exonic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007222759 6:40292118-40292140 GTGTGGAGGCAGGAGAAGGAAGG + Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1007408660 6:41649046-41649068 GAGTGGAGGCACCAGGTGGAAGG + Intronic
1007505336 6:42331435-42331457 AAGTGCAGGCAGGTGGAGGGAGG - Intronic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1008271181 6:49491958-49491980 CAGTGGTGAAAGGAGCAGGATGG + Intronic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1008863216 6:56176864-56176886 AAGGGGAGGAAAGAGGAGGAAGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1008863243 6:56176926-56176948 GGGAGGAGGAAGGAGGAGGAGGG + Intronic
1009352876 6:62704630-62704652 CAGTGAAGGCAGTAGCAAGATGG - Intergenic
1011722837 6:90176769-90176791 TGGAGGAGGCAGGAGCAGGAGGG - Intronic
1012394139 6:98776228-98776250 GGGTGGGGGCTGGAGGAGGAGGG + Intergenic
1012569315 6:100702195-100702217 TAGTGGTGGCAGAAAGAGGAGGG + Intronic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013056587 6:106589180-106589202 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013393778 6:109713730-109713752 CAGTGGAGGGAGGGAGAGGGTGG + Intronic
1013618629 6:111868083-111868105 CAGAGAAGGCTGGAAGAGGAGGG - Intronic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1014049589 6:116936528-116936550 GAGAGGAGGCAAGAGAAGGAGGG + Intergenic
1014207569 6:118672789-118672811 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1014258116 6:119184572-119184594 CTGAGGAGGCAGGAGTAGGAAGG + Intronic
1014837754 6:126179080-126179102 CAGTGGAGGCAGGTGGGTGGGGG - Intergenic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017041244 6:150310134-150310156 CAGTGGGGGAAGGTGGAGGTGGG - Intergenic
1017322082 6:153105990-153106012 CAGTCCAGGCAAGAGGATGATGG + Intronic
1017592233 6:155990068-155990090 CAATGGAGGGAGGCGGAGGAGGG - Intergenic
1017597813 6:156048188-156048210 CAGTGGAGATAAGAGCAGGAAGG - Intergenic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1017665259 6:156713756-156713778 CAAAGGAGGAGGGAGGAGGAAGG + Intergenic
1017786563 6:157761760-157761782 CCGTGGAAGCAGGTGCAGGAAGG + Intronic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018180434 6:161218228-161218250 CAGGGGAGGCAGTAGGTGGGAGG + Intronic
1018214678 6:161515161-161515183 CAGTAGATGCAGTTGGAGGAAGG - Intronic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018837503 6:167496364-167496386 CAGTGGCGGCAGGAGATGGGAGG - Intergenic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019320840 7:414566-414588 GAGTAGGGGGAGGAGGAGGAAGG - Intergenic
1019325968 7:438429-438451 CAGTGAAGGCAGGTGGGGCACGG - Intergenic
1019346170 7:531764-531786 CAGGGGAGCCACGAGGCGGAGGG + Intergenic
1019390612 7:784506-784528 TAGCTGAGGCAGGAAGAGGATGG - Intronic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019648796 7:2145107-2145129 CTGTGGAGCCAGGAGCAGGCAGG - Intronic
1019729550 7:2622679-2622701 AGGTGGGGGCAGGAGGAGCAGGG - Intergenic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020787691 7:12591147-12591169 CAGTGGAAGAATGAGTAGGAAGG + Intronic
1020812496 7:12864267-12864289 CAGGGGAGGCAGGCCAAGGAGGG - Intergenic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022478470 7:30727432-30727454 CTCTGGAGGCAGGAGGAGGGAGG + Intronic
1022902516 7:34825029-34825051 CTCAGGAGGCAGGAGGTGGAGGG - Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1023694735 7:42833432-42833454 TGTTGGAGGCAGGAGGAGCAAGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023934908 7:44732798-44732820 AGGAGGAGGCAGGAGGAGGCAGG + Intergenic
1024017347 7:45329159-45329181 CATAGGAGGAAGGAGAAGGAAGG + Intergenic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024550793 7:50561183-50561205 GAGTGGGGGCAGGAGGTGGTGGG - Intronic
1025198675 7:56949338-56949360 GGGTTGAGGGAGGAGGAGGAAGG - Intergenic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025227562 7:57178176-57178198 CAGTGCAGCCAGGAGCAGGCAGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025673273 7:63627593-63627615 GGGTTGAGGGAGGAGGAGGAAGG + Intergenic
1025730313 7:64102136-64102158 CAGTGCAGCCAGGAGCAGGCAGG + Intronic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026183489 7:68062691-68062713 GAGTGGGGGCAAGAGGAAGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026217653 7:68363989-68364011 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1026548081 7:71341931-71341953 CTGTGGATGCAGGAGGATGCAGG + Intronic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1026906079 7:74063469-74063491 CAGTGGAGCCAGGAGGTGTCTGG - Intronic
1026913613 7:74106923-74106945 GCATGCAGGCAGGAGGAGGAAGG + Intronic
1027051836 7:75025596-75025618 CAGAGGAGGGAGGAGGACGGCGG - Intergenic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027832604 7:83199140-83199162 CAGTGGAAGAAGGAGGGGCAAGG + Intergenic
1027878285 7:83799898-83799920 GAGGGGAGGCAGGAGGAATATGG + Intergenic
1028488437 7:91385196-91385218 CACTGGGGAGAGGAGGAGGAAGG - Intergenic
1028758315 7:94464111-94464133 CATTGGTGGCAGAAGCAGGAAGG - Intergenic
1028831243 7:95328493-95328515 TAAAGGAGGCAGGAGGAGCAGGG + Intergenic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029306908 7:99626273-99626295 CAGAGGAGTAAGGAGGAGGCAGG + Intronic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029422104 7:100477195-100477217 GAGGGGGGGGAGGAGGAGGAAGG + Intronic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029483222 7:100825053-100825075 CAGTGGAGAGTGGAGGAGGGAGG + Intronic
1029536530 7:101160729-101160751 AAGTGGAGGTAGGGGGTGGAGGG - Exonic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1029652962 7:101906327-101906349 GAGGTGAGGCAGGAGGAGCAGGG + Intronic
1029705633 7:102274329-102274351 CATGGGAGGAGGGAGGAGGAGGG + Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1030894226 7:115037615-115037637 CAGTGGGGAAAGGAGGAGGGTGG + Intergenic
1031153825 7:118085817-118085839 TAGTGGAGGGAGGAGAACGATGG - Intergenic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031556444 7:123182466-123182488 CAGTGGAGGAAGTGGGTGGAGGG - Intronic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1031806683 7:126316166-126316188 ACATGGTGGCAGGAGGAGGAGGG + Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032283370 7:130523847-130523869 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032284111 7:130528072-130528094 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032284887 7:130532449-130532471 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1032902071 7:136321072-136321094 CAGTGGTGGCAGCTGGAGGTGGG + Intergenic
1033282486 7:140015922-140015944 CAGTGGAGGCAGCAGCCGGGAGG + Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034129000 7:148698828-148698850 CGGCGGCGGCGGGAGGAGGAGGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034563538 7:151896441-151896463 CAGAGGAGGCCGCAGAAGGAAGG + Intergenic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035362295 7:158321542-158321564 CAGTGGAGGCAGGAGGCCTTGGG + Intronic
1035593476 8:836216-836238 CACTGGAAGCAGGAGGCGGCCGG - Intergenic
1036572890 8:9997435-9997457 CACTGGAGACAGGCTGAGGAAGG - Intergenic
1036600579 8:10256875-10256897 CATTTGGGGCAGGAGAAGGAGGG - Intronic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037059141 8:14485263-14485285 CAGCGGGGGCAGGGGGTGGAGGG - Intronic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037769241 8:21789283-21789305 CTGCGGGGGGAGGAGGAGGAGGG - Intronic
1037859204 8:22392788-22392810 CGCTGGAGCCAGGAGGAGGGAGG - Intronic
1037859302 8:22393262-22393284 AAGAGGAGGCAGGGGGAGAATGG + Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037927547 8:22855938-22855960 AGGCTGAGGCAGGAGGAGGATGG + Intronic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1038150951 8:24942121-24942143 GAAAGGAGGGAGGAGGAGGAGGG - Intergenic
1038268249 8:26052237-26052259 CAGTGGTGGCGGGGGGAGGGGGG + Intergenic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038421010 8:27434063-27434085 GAGAGGAGGAAGGAGGAGGTTGG - Intronic
1038462450 8:27728526-27728548 GAGTGGAGGCTGGAGAAGGTGGG - Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038922466 8:32099910-32099932 CAGTGGATGAAGGTGGAGGGGGG + Intronic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039793935 8:40896611-40896633 CGGAGGAGGCAGGGGGAGAAAGG + Intronic
1039918238 8:41875318-41875340 AACTGGAGGCAGGAGGAGGCAGG + Intronic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1039977067 8:42375893-42375915 TATTGAAGGCAGGAGGCGGAGGG + Intronic
1040386706 8:46919105-46919127 AAGAGGAGGCAAGGGGAGGAGGG + Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1040684674 8:49857348-49857370 GAGTGGAGGCAGGAAGAGGAAGG + Intergenic
1041434088 8:57818106-57818128 CAGTGGTGGCAGCAGCAGGCTGG - Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1041727575 8:61032231-61032253 CAGGGGTGACAGGAGCAGGAAGG + Intergenic
1041908111 8:63055697-63055719 GAGTGGAGGAATGAGGTGGAAGG - Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1042020733 8:64369986-64370008 GCGTGGAGGCCGGAGGAGGGTGG + Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042416517 8:68526883-68526905 GACAGGAGTCAGGAGGAGGAGGG + Intronic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044180705 8:89190798-89190820 AAGAGGAGGGAGGAGGAGAAGGG + Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044384711 8:91573780-91573802 AAGTGGAGGAGGGAGGGGGATGG + Intergenic
1044656506 8:94553782-94553804 CGGTGGATGGAGGAGGGGGAGGG + Intergenic
1044734040 8:95259353-95259375 AAGTGGAGGCAGGAAGGGCAGGG + Intronic
1045172470 8:99686578-99686600 AAGTGGAGGGAGGAGTGGGAAGG - Intronic
1045335158 8:101195180-101195202 CAGCTGAGGGAGGAGTAGGAAGG - Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045788541 8:105955011-105955033 CAGTGGGGGCAGGAGCAGGATGG + Intergenic
1046131671 8:109974551-109974573 CCCTAGCGGCAGGAGGAGGAAGG - Exonic
1046195603 8:110859991-110860013 CAGTGGAGCCAGGGGGAGCCAGG + Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1047254799 8:123207038-123207060 AGGTGGAGGAAGGAGAAGGAGGG - Intronic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047480104 8:125273953-125273975 CAGAGGAGGCACCTGGAGGAGGG - Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1047658352 8:127003743-127003765 GAGTGGAGGAAAGAGGAAGAAGG - Intergenic
1048007610 8:130431944-130431966 GAAAGGAGGAAGGAGGAGGAGGG + Intronic
1048284448 8:133130913-133130935 CACTGGAGGAAGAAAGAGGAGGG + Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049109817 8:140635695-140635717 CGGGGGAGGAAGGAGGAGGGAGG + Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049403968 8:142443407-142443429 CACTGGAGGCAGGTGGGGGTAGG + Intergenic
1049418694 8:142507286-142507308 CTGTGGAGCCAGGAGGACGGAGG + Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049747467 8:144269083-144269105 CCGTGGTGGTGGGAGGAGGATGG - Intronic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051278342 9:15418056-15418078 CAGTAGAGACAGGGGGAGGGGGG - Intergenic
1051365962 9:16321660-16321682 CAGTGGATGCAGCTGGAGGCTGG - Intergenic
1051501792 9:17786082-17786104 CAGTGAAGGGAGGATGGGGAAGG + Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053462133 9:38279228-38279250 GAGTGGAAGCAGGAGAGGGAGGG - Intergenic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055486878 9:76764810-76764832 CAGTGGAGGGAGAAGGATCATGG - Intronic
1056552409 9:87663159-87663181 CAGTGGAGGGTGCAGGAGTAGGG - Intronic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1057026341 9:91736615-91736637 GAGTAGAGACAGCAGGAGGAGGG + Intronic
1057151387 9:92799040-92799062 CAGTGGAGACTGGAGAAGGCCGG + Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057576430 9:96246314-96246336 CATTGGAGGGAGGAAGAGAACGG - Intronic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1058939427 9:109799368-109799390 GAGTGGAGGCAGGATGAGGCAGG + Intronic
1058944768 9:109846107-109846129 CATTGGAAGAATGAGGAGGAAGG + Intronic
1059081830 9:111258082-111258104 CAGTTAAGGCAGGAGGTGGAAGG + Intergenic
1059296555 9:113275864-113275886 CGGTGGAGGGCTGAGGAGGAAGG + Intronic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059437068 9:114283491-114283513 CCCTGGAGCCAGGAGAAGGAGGG + Intronic
1059467957 9:114481293-114481315 CAGTGGAGGGATAACGAGGATGG + Intronic
1059682866 9:116603598-116603620 CAGTTGAGGCAAGAGGATGAAGG + Intronic
1059730289 9:117050450-117050472 CAGGGGAGGAAGCAGGAGTAGGG - Intronic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1059823218 9:117997225-117997247 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1059999852 9:119948405-119948427 CACTGGTTCCAGGAGGAGGATGG - Intergenic
1060380296 9:123163969-123163991 CATGGGAGGCAGGAGTTGGAAGG + Intronic
1060446883 9:123697683-123697705 AAGTGGGGGAAGGGGGAGGAAGG - Intronic
1060504384 9:124187315-124187337 CTCTGGAGGCAAGAGGAGGCAGG - Intergenic
1060794133 9:126503329-126503351 CGGAGGCGGCAGGAGGAGGCGGG - Exonic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061212984 9:129204096-129204118 CAGATGTGGCAGGAGCAGGAAGG + Intergenic
1061273805 9:129558294-129558316 CAGTGGAGGCTGGAGCAGGATGG - Intergenic
1061283506 9:129610181-129610203 CAGGGGAGGGGGGAGGAGGGGGG + Intronic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1061498256 9:130987931-130987953 GAGCGGAGGCAGGAAGCGGAGGG + Intergenic
1061582295 9:131545614-131545636 CCATGGAGGCAGGAGCTGGAGGG + Intergenic
1061670559 9:132185872-132185894 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062192308 9:135254321-135254343 CAGTGGAGGCAGCAGGTGCTGGG - Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062289103 9:135786662-135786684 CAGTAGAGGCAGGCAGAGGGTGG - Intronic
1062343277 9:136103306-136103328 CACTGGAAGAAGGTGGAGGAGGG - Intergenic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062478170 9:136739795-136739817 CAGGGGCGGCAGGAGGTGGGAGG + Intronic
1062546254 9:137064948-137064970 CAGGGGGGCCCGGAGGAGGACGG + Exonic
1062578968 9:137221407-137221429 CAGTCCTGGGAGGAGGAGGAAGG + Intronic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1185449518 X:275089-275111 GGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1185464374 X:346113-346135 GAGTGGAGGTAGGAGGGGTAGGG + Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185575564 X:1169279-1169301 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1185610903 X:1393007-1393029 GAGAGGAGGCGGGAGGAGGGAGG - Intergenic
1185673640 X:1831190-1831212 CCCTGGAGGCAGGAGGAGGCAGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186239965 X:7555307-7555329 GAAGGGAGGAAGGAGGAGGAAGG + Intergenic
1186289118 X:8077520-8077542 CAGTTGAGGAAGGATGAGAAGGG - Intergenic
1186323033 X:8451351-8451373 AAATCGAGGCAAGAGGAGGAAGG + Intergenic
1187009467 X:15265293-15265315 CCTTGGATGCAGGATGAGGAGGG - Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187064836 X:15823179-15823201 AAGTCGTGGCAGGAGGAGGTCGG + Exonic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1188601633 X:31973527-31973549 CAGTGGGGAGAAGAGGAGGATGG - Intronic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189362237 X:40361872-40361894 CAGTGGCTGCAGGAGGAAGTGGG + Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189909351 X:45794421-45794443 CAGGGGTGGTAGGTGGAGGAGGG + Intergenic
1190029016 X:46953909-46953931 CAGGAGAGGGAGGAGGAGAAAGG - Intronic
1190051332 X:47151726-47151748 CAGTTGAGACAGTAGGAAGAAGG + Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190076720 X:47322416-47322438 CAGTGTGGGAGGGAGGAGGAGGG - Intergenic
1190418626 X:50205548-50205570 CAGTGGCTGCGGCAGGAGGATGG + Intronic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1190708268 X:53048478-53048500 CAGGGGCGGGCGGAGGAGGAGGG - Intergenic
1190739653 X:53280689-53280711 CGCAGGAGGCAGGAGGTGGAGGG - Intronic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191851318 X:65588250-65588272 GGGTGGCGGCGGGAGGAGGAAGG + Intergenic
1192102929 X:68284391-68284413 CAGTGGTGGCAGAAGAAGAAAGG - Intronic
1192481626 X:71491254-71491276 CAGTTAAGGCAGGAGGTAGAAGG + Intronic
1192795395 X:74421284-74421306 CAGTGGCGGCTGGAGTAGGTAGG + Intergenic
1192800666 X:74462055-74462077 CACTGGAGGGAAGAGGAGGCAGG - Intronic
1194318474 X:92411949-92411971 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195137117 X:101919756-101919778 CAGGGGAGGCAAGAGTATGAAGG + Intronic
1195350157 X:103987935-103987957 CAGCGGATGCAGGAGGAAAAAGG - Intergenic
1195351762 X:104003155-104003177 CAGCGGATGCAGGAGGAAAAAGG + Intergenic
1195696098 X:107668748-107668770 GAGTGGAGGCAGGAGGGAGGAGG - Intergenic
1195741870 X:108072942-108072964 CAGTGGTGGCGGGTGGAGGGGGG + Intronic
1195923107 X:110002394-110002416 CGGAGGAGGGAGGAGGAGGGAGG + Intergenic
1195923111 X:110002404-110002426 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196260754 X:113577889-113577911 CAGTGGAGGCTGGAAGAAGAAGG + Intergenic
1196762621 X:119213164-119213186 CAGTGGAGGCGGGAGGCCGGGGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197761099 X:130028910-130028932 CAGAGGAGGCAGGAGGGGGGTGG + Intronic
1197766602 X:130063394-130063416 GAGTGGTGGCAGAAGGAGCAGGG + Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198522913 X:137470980-137471002 CATTGGAGGCAGGAGGAAGGGGG - Intergenic
1198822444 X:140662974-140662996 CAGTGGCCGCAGGAGAAGCAGGG - Intergenic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1199794119 X:151178644-151178666 CGCTGGAGGAAGGAGGAAGAAGG + Intronic
1199905076 X:152218727-152218749 CAGAGGAGGAAAGAAGAGGATGG + Intronic
1199984818 X:152942791-152942813 CAGTGGAGGCAGTACAAGGGTGG + Intronic
1200141243 X:153904132-153904154 CAGGTGGGGCAGGAGGAAGAGGG + Intronic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1202257017 Y:22932074-22932096 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202410008 Y:24565822-24565844 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202460774 Y:25104250-25104272 CTGAGGAGGCAGGAAGAGAATGG + Intergenic