ID: 1091217294

View in Genome Browser
Species Human (GRCh38)
Location 11:133910257-133910279
Sequence ACGTGTCCTGCAGTTCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217291_1091217294 18 Left 1091217291 11:133910216-133910238 CCTGCACGTGTGTGTTCGTAACT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1091217294 11:133910257-133910279 ACGTGTCCTGCAGTTCGCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217294 Original CRISPR ACGTGTCCTGCAGTTCGCCG TGG Intronic
901658667 1:10785366-10785388 ACGTGGCCTGGAGTTCGTCATGG + Intronic
905714100 1:40133248-40133270 AGTTCTCCAGCAGTTCGCCGAGG + Intergenic
915118946 1:153616633-153616655 CCCTGCCCTGCAGTTCGCCAGGG - Intronic
924415387 1:243850989-243851011 GCGTCTCCTCCAGTCCGCCGCGG + Intronic
1076679802 10:132165849-132165871 ACGTGGCCTGGAGTCCACCGGGG - Intronic
1081269477 11:41065788-41065810 ACGTCTGCTGCAGTTTGCTGGGG - Intronic
1090520539 11:127474519-127474541 AAGTGTCCTGCAGCTCCCCATGG - Intergenic
1091217294 11:133910257-133910279 ACGTGTCCTGCAGTTCGCCGTGG + Intronic
1101090831 12:101283269-101283291 ACGTGTCTGGCAGTTGGCTGTGG + Intronic
1113828322 13:113274105-113274127 ACTTGTGCTGCAGTTGGCCTTGG - Intergenic
1145859148 17:28192814-28192836 ACCTGTCCTGGAGTTAGACGTGG + Intronic
1148091533 17:45025171-45025193 ACGCTTCCTGCAGTTCCCCTGGG + Intronic
1160121087 18:76130980-76131002 ACCTGTCCCACAGCTCGCCGAGG + Intergenic
1160929873 19:1565643-1565665 GCTTGTCCTGCAGGCCGCCGTGG - Intronic
1161567363 19:5011191-5011213 ACGTGTCCTGCAGGGCTCCCTGG + Intronic
926018900 2:9477243-9477265 CTGTGGCCTGCAGTTCTCCGCGG + Intronic
938772917 2:134516008-134516030 ACGTGTCCTGCAGGGTGCTGGGG + Intronic
942148445 2:173050323-173050345 ATGTGCTCTGCAGTTCGCTGTGG + Intronic
1171532728 20:25863015-25863037 ACCTGTCCTGGAGGTCACCGCGG + Intronic
1174374010 20:50113240-50113262 ACGGGTCGTGCAGGTCTCCGGGG - Intronic
1178366619 21:31993787-31993809 ACGTGTCCTCCAGGTCACCTTGG - Intronic
1185380963 22:50507425-50507447 TCGTGTCCTGCAGGCCGCTGTGG - Intronic
951072547 3:18349334-18349356 AATTGTCCTTCAGTTTGCCGTGG + Exonic
960579934 3:119268058-119268080 AGGTGTGCTGCAGTTTGCTGGGG - Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
970424764 4:15935936-15935958 ACGTGTCCTGCACTATGCTGAGG + Exonic
972861098 4:43169726-43169748 AAGTCTCCTGCAGTTTGCTGGGG - Intergenic
989641170 5:43584717-43584739 AGGTCTCCTGCAGTTCCCCTCGG - Intergenic
1006610715 6:35292723-35292745 CCGTGGCCTCCAGCTCGCCGTGG - Exonic
1006673228 6:35743044-35743066 ACCTGTCCTGCGGGTCGCCACGG + Intronic
1010795530 6:80113188-80113210 ACGTGTGTTGCAGTTGGCCATGG - Intronic
1013345650 6:109257693-109257715 ACATGTCCTGCAGCTGGCCCTGG + Intergenic
1014216070 6:118753872-118753894 ACGTCTCCTGCAGTGAGCCATGG - Intergenic
1015440686 6:133242370-133242392 ATGTCTCCTGCAGTTTGCCAGGG + Intronic
1019409256 7:899509-899531 CCGTGACCGGCAGGTCGCCGAGG + Intronic
1191651070 X:63537911-63537933 ACGTCTGCTGCAGTTTGCTGGGG - Intergenic
1200824010 Y:7620415-7620437 GCGTGCCCTGCAGTTGGCCATGG + Intergenic
1202236045 Y:22710673-22710695 GCGTGCCCTGCAGTTGGCCATGG - Intergenic
1202307118 Y:23485495-23485517 GCGTGCCCTGCAGTTGGCCATGG + Intergenic
1202563687 Y:26185091-26185113 GCGTGCCCTGCAGTTGGCCATGG - Intergenic