ID: 1091217870

View in Genome Browser
Species Human (GRCh38)
Location 11:133914564-133914586
Sequence GCTGTTTCTCAAGGGAAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217870_1091217873 -4 Left 1091217870 11:133914564-133914586 CCGATTTTCCCTTGAGAAACAGC 0: 1
1: 0
2: 0
3: 29
4: 249
Right 1091217873 11:133914583-133914605 CAGCCAAGCTCCAGCCCTTCCGG 0: 1
1: 0
2: 1
3: 18
4: 301
1091217870_1091217881 26 Left 1091217870 11:133914564-133914586 CCGATTTTCCCTTGAGAAACAGC 0: 1
1: 0
2: 0
3: 29
4: 249
Right 1091217881 11:133914613-133914635 GCTGTCCACCTGTTTAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1091217870_1091217882 27 Left 1091217870 11:133914564-133914586 CCGATTTTCCCTTGAGAAACAGC 0: 1
1: 0
2: 0
3: 29
4: 249
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217870_1091217874 -3 Left 1091217870 11:133914564-133914586 CCGATTTTCCCTTGAGAAACAGC 0: 1
1: 0
2: 0
3: 29
4: 249
Right 1091217874 11:133914584-133914606 AGCCAAGCTCCAGCCCTTCCGGG 0: 1
1: 1
2: 4
3: 35
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217870 Original CRISPR GCTGTTTCTCAAGGGAAAAT CGG (reversed) Intronic