ID: 1091217871

View in Genome Browser
Species Human (GRCh38)
Location 11:133914572-133914594
Sequence GGAGCTTGGCTGTTTCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217871_1091217882 19 Left 1091217871 11:133914572-133914594 CCCTTGAGAAACAGCCAAGCTCC 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217871_1091217881 18 Left 1091217871 11:133914572-133914594 CCCTTGAGAAACAGCCAAGCTCC 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1091217881 11:133914613-133914635 GCTGTCCACCTGTTTAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217871 Original CRISPR GGAGCTTGGCTGTTTCTCAA GGG (reversed) Intronic