ID: 1091217872

View in Genome Browser
Species Human (GRCh38)
Location 11:133914573-133914595
Sequence TGGAGCTTGGCTGTTTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217872_1091217881 17 Left 1091217872 11:133914573-133914595 CCTTGAGAAACAGCCAAGCTCCA 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1091217881 11:133914613-133914635 GCTGTCCACCTGTTTAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1091217872_1091217882 18 Left 1091217872 11:133914573-133914595 CCTTGAGAAACAGCCAAGCTCCA 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217872 Original CRISPR TGGAGCTTGGCTGTTTCTCA AGG (reversed) Intronic