ID: 1091217875

View in Genome Browser
Species Human (GRCh38)
Location 11:133914586-133914608
Sequence GTCCCGGAAGGGCTGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217875_1091217881 4 Left 1091217875 11:133914586-133914608 CCAAGCTCCAGCCCTTCCGGGAC 0: 1
1: 0
2: 0
3: 36
4: 255
Right 1091217881 11:133914613-133914635 GCTGTCCACCTGTTTAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1091217875_1091217882 5 Left 1091217875 11:133914586-133914608 CCAAGCTCCAGCCCTTCCGGGAC 0: 1
1: 0
2: 0
3: 36
4: 255
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217875_1091217885 30 Left 1091217875 11:133914586-133914608 CCAAGCTCCAGCCCTTCCGGGAC 0: 1
1: 0
2: 0
3: 36
4: 255
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217875 Original CRISPR GTCCCGGAAGGGCTGGAGCT TGG (reversed) Intronic