ID: 1091217877

View in Genome Browser
Species Human (GRCh38)
Location 11:133914597-133914619
Sequence GGACAGCAGGTGTCCCGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217877_1091217881 -7 Left 1091217877 11:133914597-133914619 CCCTTCCGGGACACCTGCTGTCC 0: 1
1: 0
2: 3
3: 10
4: 166
Right 1091217881 11:133914613-133914635 GCTGTCCACCTGTTTAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1091217877_1091217887 30 Left 1091217877 11:133914597-133914619 CCCTTCCGGGACACCTGCTGTCC 0: 1
1: 0
2: 3
3: 10
4: 166
Right 1091217887 11:133914650-133914672 CATAGCCACAGGACAAAAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 214
1091217877_1091217882 -6 Left 1091217877 11:133914597-133914619 CCCTTCCGGGACACCTGCTGTCC 0: 1
1: 0
2: 3
3: 10
4: 166
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217877_1091217885 19 Left 1091217877 11:133914597-133914619 CCCTTCCGGGACACCTGCTGTCC 0: 1
1: 0
2: 3
3: 10
4: 166
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217877 Original CRISPR GGACAGCAGGTGTCCCGGAA GGG (reversed) Intronic