ID: 1091217878

View in Genome Browser
Species Human (GRCh38)
Location 11:133914598-133914620
Sequence TGGACAGCAGGTGTCCCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217878_1091217881 -8 Left 1091217878 11:133914598-133914620 CCTTCCGGGACACCTGCTGTCCA 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1091217881 11:133914613-133914635 GCTGTCCACCTGTTTAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1091217878_1091217885 18 Left 1091217878 11:133914598-133914620 CCTTCCGGGACACCTGCTGTCCA 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217878_1091217887 29 Left 1091217878 11:133914598-133914620 CCTTCCGGGACACCTGCTGTCCA 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1091217887 11:133914650-133914672 CATAGCCACAGGACAAAAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 214
1091217878_1091217882 -7 Left 1091217878 11:133914598-133914620 CCTTCCGGGACACCTGCTGTCCA 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217878 Original CRISPR TGGACAGCAGGTGTCCCGGA AGG (reversed) Intronic