ID: 1091217879

View in Genome Browser
Species Human (GRCh38)
Location 11:133914602-133914624
Sequence CAGGTGGACAGCAGGTGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217879_1091217885 14 Left 1091217879 11:133914602-133914624 CCGGGACACCTGCTGTCCACCTG 0: 1
1: 0
2: 4
3: 66
4: 372
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217879_1091217887 25 Left 1091217879 11:133914602-133914624 CCGGGACACCTGCTGTCCACCTG 0: 1
1: 0
2: 4
3: 66
4: 372
Right 1091217887 11:133914650-133914672 CATAGCCACAGGACAAAAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217879 Original CRISPR CAGGTGGACAGCAGGTGTCC CGG (reversed) Intronic