ID: 1091217880

View in Genome Browser
Species Human (GRCh38)
Location 11:133914610-133914632
Sequence GAGCTAAACAGGTGGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217880_1091217887 17 Left 1091217880 11:133914610-133914632 CCTGCTGTCCACCTGTTTAGCTC 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1091217887 11:133914650-133914672 CATAGCCACAGGACAAAAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 214
1091217880_1091217885 6 Left 1091217880 11:133914610-133914632 CCTGCTGTCCACCTGTTTAGCTC 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217880_1091217889 23 Left 1091217880 11:133914610-133914632 CCTGCTGTCCACCTGTTTAGCTC 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1091217889 11:133914656-133914678 CACAGGACAAAAGAAGGCTCTGG 0: 1
1: 0
2: 2
3: 22
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217880 Original CRISPR GAGCTAAACAGGTGGACAGC AGG (reversed) Intronic