ID: 1091217882

View in Genome Browser
Species Human (GRCh38)
Location 11:133914614-133914636
Sequence CTGTCCACCTGTTTAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217877_1091217882 -6 Left 1091217877 11:133914597-133914619 CCCTTCCGGGACACCTGCTGTCC 0: 1
1: 0
2: 3
3: 10
4: 166
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217871_1091217882 19 Left 1091217871 11:133914572-133914594 CCCTTGAGAAACAGCCAAGCTCC 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217878_1091217882 -7 Left 1091217878 11:133914598-133914620 CCTTCCGGGACACCTGCTGTCCA 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217870_1091217882 27 Left 1091217870 11:133914564-133914586 CCGATTTTCCCTTGAGAAACAGC 0: 1
1: 0
2: 0
3: 29
4: 249
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217875_1091217882 5 Left 1091217875 11:133914586-133914608 CCAAGCTCCAGCCCTTCCGGGAC 0: 1
1: 0
2: 0
3: 36
4: 255
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217872_1091217882 18 Left 1091217872 11:133914573-133914595 CCTTGAGAAACAGCCAAGCTCCA 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1091217876_1091217882 -2 Left 1091217876 11:133914593-133914615 CCAGCCCTTCCGGGACACCTGCT 0: 1
1: 0
2: 1
3: 17
4: 267
Right 1091217882 11:133914614-133914636 CTGTCCACCTGTTTAGCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217882 Original CRISPR CTGTCCACCTGTTTAGCTCT GGG Intronic