ID: 1091217883

View in Genome Browser
Species Human (GRCh38)
Location 11:133914618-133914640
Sequence TGAGCCCAGAGCTAAACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217883_1091217889 15 Left 1091217883 11:133914618-133914640 CCACCTGTTTAGCTCTGGGCTCA 0: 1
1: 0
2: 1
3: 19
4: 154
Right 1091217889 11:133914656-133914678 CACAGGACAAAAGAAGGCTCTGG 0: 1
1: 0
2: 2
3: 22
4: 289
1091217883_1091217885 -2 Left 1091217883 11:133914618-133914640 CCACCTGTTTAGCTCTGGGCTCA 0: 1
1: 0
2: 1
3: 19
4: 154
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217883_1091217887 9 Left 1091217883 11:133914618-133914640 CCACCTGTTTAGCTCTGGGCTCA 0: 1
1: 0
2: 1
3: 19
4: 154
Right 1091217887 11:133914650-133914672 CATAGCCACAGGACAAAAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217883 Original CRISPR TGAGCCCAGAGCTAAACAGG TGG (reversed) Intronic