ID: 1091217884

View in Genome Browser
Species Human (GRCh38)
Location 11:133914621-133914643
Sequence TGCTGAGCCCAGAGCTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217884_1091217885 -5 Left 1091217884 11:133914621-133914643 CCTGTTTAGCTCTGGGCTCAGCA 0: 1
1: 0
2: 0
3: 18
4: 144
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217884_1091217889 12 Left 1091217884 11:133914621-133914643 CCTGTTTAGCTCTGGGCTCAGCA 0: 1
1: 0
2: 0
3: 18
4: 144
Right 1091217889 11:133914656-133914678 CACAGGACAAAAGAAGGCTCTGG 0: 1
1: 0
2: 2
3: 22
4: 289
1091217884_1091217887 6 Left 1091217884 11:133914621-133914643 CCTGTTTAGCTCTGGGCTCAGCA 0: 1
1: 0
2: 0
3: 18
4: 144
Right 1091217887 11:133914650-133914672 CATAGCCACAGGACAAAAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217884 Original CRISPR TGCTGAGCCCAGAGCTAAAC AGG (reversed) Intronic