ID: 1091217885

View in Genome Browser
Species Human (GRCh38)
Location 11:133914639-133914661
Sequence CAGCACCGAAGCATAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091217880_1091217885 6 Left 1091217880 11:133914610-133914632 CCTGCTGTCCACCTGTTTAGCTC 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217877_1091217885 19 Left 1091217877 11:133914597-133914619 CCCTTCCGGGACACCTGCTGTCC 0: 1
1: 0
2: 3
3: 10
4: 166
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217883_1091217885 -2 Left 1091217883 11:133914618-133914640 CCACCTGTTTAGCTCTGGGCTCA 0: 1
1: 0
2: 1
3: 19
4: 154
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217876_1091217885 23 Left 1091217876 11:133914593-133914615 CCAGCCCTTCCGGGACACCTGCT 0: 1
1: 0
2: 1
3: 17
4: 267
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217878_1091217885 18 Left 1091217878 11:133914598-133914620 CCTTCCGGGACACCTGCTGTCCA 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217875_1091217885 30 Left 1091217875 11:133914586-133914608 CCAAGCTCCAGCCCTTCCGGGAC 0: 1
1: 0
2: 0
3: 36
4: 255
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217884_1091217885 -5 Left 1091217884 11:133914621-133914643 CCTGTTTAGCTCTGGGCTCAGCA 0: 1
1: 0
2: 0
3: 18
4: 144
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1091217879_1091217885 14 Left 1091217879 11:133914602-133914624 CCGGGACACCTGCTGTCCACCTG 0: 1
1: 0
2: 4
3: 66
4: 372
Right 1091217885 11:133914639-133914661 CAGCACCGAAGCATAGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091217885 Original CRISPR CAGCACCGAAGCATAGCCAC AGG Intronic