ID: 1091220507

View in Genome Browser
Species Human (GRCh38)
Location 11:133927591-133927613
Sequence GTCATTATGGTCTTATACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220507_1091220523 23 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220523 11:133927637-133927659 CAGGATCCCTAAGGCCGTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 59
1091220507_1091220512 -3 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220512 11:133927611-133927633 GACCAGGGGTTTCCCCACAGTGG 0: 1
1: 0
2: 1
3: 16
4: 270
1091220507_1091220515 -1 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220515 11:133927613-133927635 CCAGGGGTTTCCCCACAGTGGGG 0: 1
1: 0
2: 0
3: 20
4: 189
1091220507_1091220524 27 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220507_1091220516 4 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220516 11:133927618-133927640 GGTTTCCCCACAGTGGGGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 167
1091220507_1091220522 22 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220522 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1091220507_1091220513 -2 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220513 11:133927612-133927634 ACCAGGGGTTTCCCCACAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 139
1091220507_1091220520 14 Left 1091220507 11:133927591-133927613 CCAGGGTATAAGACCATAATGAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1091220520 11:133927628-133927650 CAGTGGGGCCAGGATCCCTAAGG 0: 1
1: 0
2: 1
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220507 Original CRISPR GTCATTATGGTCTTATACCC TGG (reversed) Intronic