ID: 1091220511

View in Genome Browser
Species Human (GRCh38)
Location 11:133927604-133927626
Sequence GGGGAAACCCCTGGTCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091220511_1091220523 10 Left 1091220511 11:133927604-133927626 CCATAATGACCAGGGGTTTCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1091220523 11:133927637-133927659 CAGGATCCCTAAGGCCGTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 59
1091220511_1091220524 14 Left 1091220511 11:133927604-133927626 CCATAATGACCAGGGGTTTCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1091220524 11:133927641-133927663 ATCCCTAAGGCCGTAAGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 38
1091220511_1091220522 9 Left 1091220511 11:133927604-133927626 CCATAATGACCAGGGGTTTCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1091220522 11:133927636-133927658 CCAGGATCCCTAAGGCCGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1091220511_1091220527 21 Left 1091220511 11:133927604-133927626 CCATAATGACCAGGGGTTTCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1091220527 11:133927648-133927670 AGGCCGTAAGGGTTGGAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1091220511_1091220516 -9 Left 1091220511 11:133927604-133927626 CCATAATGACCAGGGGTTTCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1091220516 11:133927618-133927640 GGTTTCCCCACAGTGGGGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 167
1091220511_1091220520 1 Left 1091220511 11:133927604-133927626 CCATAATGACCAGGGGTTTCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1091220520 11:133927628-133927650 CAGTGGGGCCAGGATCCCTAAGG 0: 1
1: 0
2: 1
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091220511 Original CRISPR GGGGAAACCCCTGGTCATTA TGG (reversed) Intronic